Der chinesische Menschenversuch

Mittwoch 28. 11.2018

Einen Tag später ist das Medieninteresse ungebrochen. So gibt es ein NDTV Hongkong Conference Update

Summit chair David Baltimore, a Nobel laureate, said there had been “a failure of self-regulation by the scientific community because of a lack of transparency.” He’s claim would “be considered irresponsible”, Baltimore said.

The Nation

Qiu Renzong, formerly the vice president of the Chinese Ministry of Health’s ethics committee, told reporters at the gene editing conference that lax regulations in China mean that scientists who break the rules often face no punishment, and think of the ministry as being “without teeth”.

The Atlantic

The announcement was shocking in many ways: He made it via YouTube video. He doesn’t yet have a scientific paper to back up his claims. He’s a relative outsider with little published gene-editing experience. His own university now claims it was kept in the dark about his incredibly controversial research. If you were trying to concoct a scenario that inflamed all the worst fears about Chinese science, could you do better than this?

Ich verstehe dabei den Aufschrei nicht so recht. Gab es bei den ersten genmodifizierten Affen in China 2014 ( Luo et al.) überhaupt eine Reaktion?

Fortune

Bioethicist Alta Charo of the University of Wisconsin raised an entirely different point. “The children were already at virtually no risk of contracting HIV because it was the father and not the mother who was infected,” she said at the conference.

CNBC

“This is criminally reckless and I unequivocally condemn the experiment,” said Hank Greely, director of the center for law and the biosciences at Stanford University … The near-term consequence of this kind of research could be “sick babies, disabled babies, dead babies,” said Greely. Some high-profile critics, including Harvard University’s well-known geneticist George Church, shared concerns with the AP about the method that the researchers in China used to edit the embryos, as it appears that the HIV infection can still occur if only certain cells were altered.

Tagesspiegel

Staats- und Parteichef Xi Jinping machte es zu einem der Ziele des Landes, auch im Bereich Biotechnologie weltweit führend zu werden. Im 13ten Fünfjahresplan (2016- 2020) wurde Genomforschung als ein Bereich identifiziert, der sich für Direktinvestitionen lohne. Seitdem fließen die Gelder in die Genforschung. Erst im Dezember 2017 wurde das „100 000-Genome-Projekt“ ins Leben gerufen, das das Erbgut genauso vieler Menschen sequenzieren soll. Dafür gibt Chinas Ministerium für Wissenschaft und Technologie über elf Milliarden Euro aus.

Wired Artikel

We said “don’t freak out,” when scientists first used Crispr to edit DNA in non-viable human embryos. When they tried it in embryos that could theoretically produce babies, we said “don’t panic.” Many years and years of boring bench science remain before anyone could even think about putting it near a woman’s uterus. Well, we might have been wrong. Permission to push the panic button granted.

Langsam wird damit auch der Ablauf seit dem letzten Wochenende klar, wenn man dem Wired Artikel glaubt. Danach fand zuerst MIT Technology Review am 25.11. einen Eintrag in dem chinesischen Register, dass ein solcher Versuch läuft. Eingetragen wurde am am 6.11.18, also mehr als 1 Jahr nach dem Beginn der Versuche am 7.3.2017, dem Tag der eingetragenen Genehmigung durch die Ethik Kommission. Das Dokument wurde aber laut Metadaten erst am 16.5.2017 erstellt.

PDF Metadaten Ethik

Wann der Registereintrag online ging, ist nicht klar, er wird aber offensichtlich immer wieder noch geändert, zuletzt am 26.11.18. Mit der Datierung des Excel Sheets (siehe unten), den vielen fehlgeschlagenen Versuchen und den weiteren 9 Monaten der Zwillingsschwangerschaft, hat He bereits lange vor der Freistellung an der Universität im Februar 2018 an dem Trial gearbeitet.

Screenshot Registereintrag

Wohl auf den MIT Artikel hin, lädt He panikartig seine vorbereiteten Werbevideos hoch, da sein eigentlich geplanter Artikel zur Ethik nicht mehr vor der Hongkong Konferenz online gehen wird. MIT Technology Review am 27.11. hat  dazu weitere Hintergrundinformationen. He Jiankui beruft sich auf ein “US National Academies of Sciences, Engineering, and Medicine” Statement, das ähnlich wie der britische Nuffield Report Wissenschaft keine Vorschriften machen will.  Nach dem Registerdokument ist  “primary sponsor” die Southern University of Science in Shenzhen. Da das Trial aber erst so spät und mit falschen Daten eingetragen wurde, sind Zweifel auch an diesen Angaben berechtigt.

Überliefert aus Honkong ist das nervöse Auftreten von He.

He seemed shaky approaching the stage and nervous during the talk. “I think he was scared,” says Matthew Porteus, who researches gene editing at Stanford University in California and co-hosted a question-and-answer session with He after his presentation. Porteus attributed He’s nervous demeanor to either the legal pressures that He faces or to the prospect of addressing a critical audience of scientists and members of the media.

Kein Wunder, er muss ja auch ein völlig blödsinniges Vorgehen rechtfertigen.

At the summit, He revealed that one of the genetically modified twins will be resistant to HIV, because the gene edits removed both copies of her CCR5 gene. The other twin could still be susceptible to infection because the gene-editing process inadvertently left one copy of her CCR5 intact, he said. He’s decision to implant the second embryo drew strong criticism. “Why choose this embryo? It just doesn’t make sense scientifically,” said Seoul National University geneticist Jin-Soo Kim. During his talk, He said he had explained the situation to the parents and they decided they wanted to do it anyway.

Die erste Reaktion des Gene Summits in Hongkong fällt dann aber doch verblüffend nichtssagendend aus:

One such study, a 2017 report by the U.S. National Academies of Sciences, Engineering, and Medicine, concluded that clinical trials might be permitted after peer-reviewed preclinical research further clarifies the potential risks and benefits, only for compelling medical reasons in the absence of reasonable alternatives, and with maximum transparency and strict oversight. The report noted that such research should be approached with caution and with broad public input. It specified a regulatory framework that included ten recommended criteria and structures. … Whether the clinical protocols that resulted in the births in China conformed with the guidance in these studies remains to be determined.

was entsprechende Reaktionen provoziert

Twitter Screenshot

Damit gehe ich nun nicht mehr von einem Einzeltäter aus – seine Arbeitsgruppe an der Universität bestehend aus Jinzhou Qin, Shuo Song und Xiaoqing Zhou muss schliesslich auch an irgendetwas gearbeitet haben. Stellenausschreibungen auf seiner nicht mehr online verfügbaren Webseite beschreiben das Forschungsprogramm:

Multiple postdoctoral positions are available in Dr. Jiankui He’s laboratory in South University of Science and Technology of China (SUSTC). Dr. He is building up the Genome Center at SUSTC, with the most advanced high throughput sequencers such as Illumina Hiseq, Miseq, Ion Torrent and Roche 454. We are initiating an international collaborative study “The International Human Immunome Project”. The International Human Immunome Project aims to sequence the immune repertoire of 10,000 patients and identify disease-specific T or B cell receptor sequences for 100 diseases such as cancers, autoimmune diseases, infectious diseases and other immune related diseases.
Position A:candidates should have research experience in immunology, preferably, B cells and T cells.
Position B: candidates should have research experience in cancer biology, preferably, tumor immunology.
Position C: candidates should have extensive research experience in high throughput sequencing.
The salary for these positions is 150,000-200,000 RMB per year. Contract is renewable. Candidates has previous postdoc research experience are able to consider for research scientist position.

Von der Crispr Szene vielleicht aktuell sicher nicht gewollt, in China aber eher akzeptabel, kann sich He Jiankui in der Tat auf diverse einschlägige Dokumente berufen. Und er war nicht ganz der Aussenseiter wie er jetzt gerade hingestellt wird und hat 2017 in Cold Spring Harbor gesprochen, so STAT

He’s career trajectory highlights a few salient facts: His scientific background is wide-ranging, but lacking in deep expertise in CRISPR and embryology. Public records indicate that he is just 34 years old, an age when many top researchers are just opening up their first labs.
He, who appears to have been born and raised in China, earned his undergraduate degree in physics from the University of Science and Technology of China in 2006. He then moved to Texas to earn his Ph.D., in biophysics, at Rice University in Houston; his adviser there, the bioengineering professor Michael Deem, would later collaborate with him on the CRISPR’d embryos project.
After graduating in 2010, He spent about a year doing his postdoc in the lab of Stanford bioengineer Stephen Quake. It was there that He learned about single-molecule sequencing ― a then-revolutionary method of sequencing single DNA molecules without first having to copy them using polymerase chain reaction, according to a 2015 story in the publication Bio-IT World.
He moved back to China around 2012. It’s not clear why he decided to return home, but a few factors may have come into play. He wanted to spin off companies from his academic research back in China, according to Bio-IT World. And financial incentives may have contributed to his decision: He moved back to China as part of the Thousand Talents program, an initiative in which the Chinese government has offered incentives to try to bring back its best and brightest scientists and entrepreneurs who did their training in the U.S.

Ethik wird zur Akzeptanzbeschaffung degradiert, zumal nun auch heute sein länger geplanter Artikel in einem predatory journal online ging (Liebert, Volume 1, Number 6, “authors are asked to fill out a short open access order form. You can pay by credit card”). Hier wiederholt He Jiankui (zusammen mit  Ryan Ferrell,  Chen Yuanlin, Qin Jinzhou und Chen Yangran) seine selbstkonstruierten Regeln, wohl ahnend, dass die Akzeptanzgering sein wird.

Interessenskonflikte: keine. Dabei kam heute heraus, dass He seit 2015 eine eigene Firma betreibt: directgenomics.com (zusammen Qin Yan, Liangjin Ye, Zefei Jiang, Zhiliang Zhou, Luyang Zhao). Über weitere Firmenbeteiligungen wird spekuliert. Die Sequenziertechnik ist schwer einzuschätzen, ein Einzelmolekülverfahren, rebranded oder Eigenentwicklung? Ich hoffe, er hat die Embryos nicht damit sequenziert, Details auf nature biotechnology review.

Sequence providers, potential customers, are in wait-and-watch mode. Ruiqiang Li, CEO of the Beijing-based genomics services provider Novogene, which has one of the few Illumina HiSeq X Ten whole genome sequencing platforms in China, says that by avoiding PCR amplification, single-molecule sequencing avoids bias, but a high error rate has proved a challenge. “It’s a very important step forward. But we see that Helicos failed, and PacBio and Oxford Nanopore have very high sequencing error rate,” says Li.

Ich vermute mal , er hat bei B.G.I. Shenzhen sequenzieren lassen.

Bei den Antragsunterlagen habe ich zudem ein Excel Sheet in dem Register gefunden, das lauf Metadaten vom 5.6.2015 stammt, also fast 2 Jahre älter als der bisher angenommene Versuchsbeginn am 7.3.2017 (2012 kam er nach China zurück).

Excel Metadaten

Tabelle 1 fehlt in dem Excel Sheet. In Tabelle 2 findet sich für beide Embryos (?) die Zusammenfassung einer genomweiten (?) Auswertung. Fragezeichen deshalb, weil es  extrem wenig Einträge aufweist.

Beide Kinder haben wohl genetisch das Risiko eines Glutaryl-CoA-Dehydrogenase-Mangel, eine autosomal-rezessiv vererbte neurometabolische Störung mit enzephalopathischen Krisen durch Striatum-Läsionen und schwerer dystonisch-dyskinetischer Bewegungsstörung. Neugeborene sind meist symptomfrei, haben aber in 75% der Fälle eine Makrozephalie. Wissen das die Eltern von Lulu und Nana oder weiss das nur das Internet? Ich glaube nicht, dass die Variante rs8012 de novo aufgetreten ist. In zwei unabhängigen Zygoten dieselbe Mutation? rs8012 ist signifikant mit Glutaroylcarnitin Spiegel assoziert (Shin 2014) führt zu dem Aminoaustausch GLN417ARG, den ich bei OMIM nicht finde (dort gibt es VAL400MET, ARG402TRP, THR416ILE, ALA421VAL). Nach einer ägyptischen Arbeit liegt der SNP rs8012  im 3’UTR und ist wohl eher geringer phänotypisch wirksam, als die anderen GCDH Mutationen.

Es sieht nach dem Excel Sheet so aus, als hätte He Jiankui der schwangeren Mutter in der 12., 19. und  24. Woche Blut abgenommen, um cfDNA (zellfreie fetale DNA) zu sequenzieren. Das war dann wohl die ganze medizinische Kontrolle während der Schwangerschaft? Keine Amniozentese?

Die erste Sequenz “CAGAATTTATACCCACACTAGGG”auf chr1 ist off target, mir ist nicht klar, was sie an der Stelle soll. Die zweite “CAGAATTGATACTGACTGTATGG” mit einem 6 Basen Offset auf chr3 ist im CCR5 Locus und taucht ansonsten nur noch in einem chinesischen Paper auf (“Inhibition of HIV-1 infection of primary CD4+ T cells by gene editing of CCR5 using adenovirus-delivered CRISPR/Cas9” sowie in einem PNAS Artikel (“Human genetic variation alters CRISPR-Cas9 on- and off-targeting specificity at therapeutically implicated loci”). Das waren also seine “Vorversuche” – einfach etwas aus der Literatur abgeschrieben.

Ärzteblatt

Eine unabhängige Bestätigung für Hes Behauptung gab es zunächst nicht. Der Wissenschaftler betonte aber, er habe Forschungsunterlagen bei einer Fachzeitschrift eingereicht. Gleichzeitig gab er an, seine Forschung sei unerwartet an die Öffent­lichkeit gedrungen. Dies ist umso erstaunlicher, als He die Nachricht in einer Ansprache über Youtube selbst verbreitet hatte – kurz vor Beginn des Kongresses.
Dort waren die Versuche das dominierende Thema. „He hat in einer großen Halle der Universität gesprochen, und die war bis auf den letzten Platz voll“, sagte der Biochemiker Ernst-Ludwig Winnacker, der an dem Kongress teilnahm. „Er machte einen gut vorbereiteten Eindruck und trat sehr selbstbewusst auf.“ Bei dem Vortrag wiederholte He, er habe mehrere kinderlose Paare aus gesunder Mutter und HIV-infiziertem Vater dazu gebracht, bei den Versuchen mitzumachen. Am Ende habe eines der Paare Zwillinge bekommen. „Auf diesen speziellen Fall bin ich wirklich stolz“, sagte er.

Wired

It’s too soon to say whether He’s stunt will bring him fame or just infamy. He’s still scheduled to speak at the human genome editing summit on Wednesday and Thursday. And China’s central government in Beijing has yet to come down one way or another. Condemnation would make He a rogue and a scientific outcast. Anything else opens the door for a Crispr IVF cottage industry to emerge in China and potentially elsewhere.