Der chinesische Menschenversuch

Der geplante Tabubruch – eine kommentierte Presse- und Literaturschau.

Wir haben es lange gefürchtet, es wird ein verrückter Einzeltäter sein, der als erster einen genmanipulierten Menschen produzieren wird. Nature berichtet heute mittag über eine Serie von Youtube Videos, die bereits gestern am 25.11. hochgeladen wurden.

He Jiankui, a genome-editing researcher from the Southern University of Science and Technology of China in Shenzhen, says that he implanted into a woman an embryo that had been edited to disable the genetic pathway that allows a cell to be infected with HIV … The scientist’s claims have not been verified through independent genome testing or published in a peer-reviewed journal. But, if true, the birth would represent a significant — and controversial — leap in the use of genome-editing. So far these tools have only be used in embryos for research, often to investigate the benefit of using them to eliminate disease-causing mutations from the human germline. But reports of off-target effects in some studies have raised significant safety concerns.

Die Literaturliste auf der Website von Jiankui He ist bescheiden, die schlecht synchronisierten Videos eines radebrechenden Chinesen vor einer Laborkulisse triefen von Sendungsbewusstsein. Ist das Ganze nur ein Fake?

Twitter Screenshot

Ich frage mich natürlich, wieviele Embryos er wohl im Lauf der IVF Zeugung zerstört hat (20.000 laut Video), wieviele off-target sites er bei den Kindern produziert hat und was wohl ein zerstörter CCR5 Rezeptor bedeutet? Immerhin gibt es Erfahrung mit der CCR5 Deletion Δ32 eines Berliner Patienten. Sie stellt bei der viralen Enzephalitis und West Nile einen Nachteil dar. Ganz abgesehen davon haben IVF Kinder generell erhebliche Nachteile, von Geburtsdefekten angefangen, Methylierungsdefekten, Grösse und Gewichtsabweichungen bis hin zu vaskulären Störungen wie Hypertonie.

So verurteilen deutsche Ethiker unisono den Versuch als Grenzüberschreitung. Christiane Woopen im Tagesanzeiger.

Die chinesischen Forscher haben Menschenrechte verletzt und der Vertrauenswürdigkeit der Wissenschaft schweren Schaden zugefügt. Das sollte die internationale Gemeinschaft nicht dulden.

Der Vorsitzende des Deutschen Ethikrats, Peter Dabrock, in der FAZ

Sollte es sich bewahrheiten, dass ein mithilfe von Crispr genmanipuliertes Baby erzeugt worden ist, wäre dies für die
Wissenschaft ein Super-Gau. Dass ausgerechnet am Tag vor dem weltweiten Wissenschaftsgipfel in Hongkong, der über den verantwortlichen Umgang mit genome editing beim Menschen berät, ein solches Experiment bekannt wird, kann ja fast nur als Affront gegenüber dem Ansinnen verantwortlicher Wissenschaft gewertet werden.

Und die Welt fasst die erste chinesische Reaktion zusammen

Nicht nur international reagieren Forscher entsetzt, auch in China scheint der Versuch höchst umstritten: 122 chinesische Wissenschaftler haben in einem Protestbrief mit scharfer Kritik auf die Ankündigung ihres Kollegen He Jiankui reagiert. „Direkte Versuche am Menschen können nur als verrückt beschrieben werden“, heißt es darin. Es sei zwar möglich, dass die Kinder, die diesmal geboren wurden, für einen bestimmten Zeitraum gesund sind. „Aber die potenziellen Risiken und Schäden für die gesamte Menschheit, die durch einen ungerechtfertigten Einsatz des Verfahrens in der Zukunft entstehen können, sind unermesslich.“

Technology Review “Die CRISPR-Babys sind da”

Der Versuch, Kinder vor HIV zu schützen, fällt in eine ethische Grauzone zwischen Behandlung und Verbesserung. Das Verfahren heilt keine Krankheit oder Störung im Embryo, sondern will einen Gesundheitsvorteil schaffen, so wie ein Impfstoff vor Windpocken schützt […] In der chinesischen Gesellschaft ist der Gedanke stark, dass ein großen Vorteil für die Gemeinschaft schwerer wiegt als die Ethik des Individuums.

Technology Review liegt da etwas daneben, das ist keine ethische Grauzone, Enhancement ist keine Behandlung, sondern Eugenik.

Die Forderung nach einer Gentherapie Überwachungsbehörde (analog zur Internationalen Atomenergie-Organisation) ist berechtigt, aber naiv. Für die Urananreicherung braucht man Anlagen mit große Gaszentrifugen, das geht nicht im Hinterhof.  Zum Genome Editing braucht man ausser einem Ultraschallgerät, Brutschrank und Mikroskop für die IVF/PID und ein paar molekularbiologische Kits noch eine Firma, die einem das Genom sequenziert (Die GRÜNEN wollten in dem ersten Entwurf für das deutschen Gendiagnostikgesetz auch PCR Reagenzien unter Überwachung stellen, worüber aber heute niemand mehr reden will). Ich finde hier ist die Legislative gefordert und zwar weltweit.

Verge

If someone wants to create gene-edited babies, who would stop them? The legal framework around gene-editing babies is murky at best.

Interessant sind die unzähligen Kommentare unter den Artikeln, die in einer Stunde akkumulieren, beispielsweise

Das mit Begeisterung aufgenommene, erstes geklonte Schaf ,Dolly‘ musste nach 6 Jahren eingeschläfert werden. Über die Ursachen wird bis heute nur spekuliert. Die beiden Chinesinnen würden in dieser Relation nach 25 Jahren nicht mehr lebensfähig. … Das ganze Risiko ist in dieser Situation einfach unkalkulierbar. Das wiederum kümmert aber die Wissenschaft nur selten. Kurz vor dem ersten Atomtest im Alamogordo 1945, wurde der führende Physiker E. Teller gefragt: gäbe es irgendwelche Risiken bei der unvorstellbaren Konzentration an Energie nach der Zündung? Ja, doch … sagte der zukünftige Vater der Wasserstoffbombe: wenn wir Pech haben, können wir die Atmosphäre anzünden und in paar Minuten gibt es keinen Sauerstoff mehr auf Erden. Es war nicht sehr plausibel, aber unmöglich war das nicht. Nicht mal annähernde Experimente wurden vorher auf diesem Gebiet durchgeführt. Sie haben [sie] trotzdem gezündet.

Einen Tag später, Mittwoch 28. November, ist das Medieninteresse ungebrochen. So gibt es ein NDTV Hongkong Conference Update

Summit chair David Baltimore, a Nobel laureate, said there had been “a failure of self-regulation by the scientific community because of a lack of transparency.” He’s claim would “be considered irresponsible”, Baltimore said.

The Nation

Qiu Renzong, formerly the vice president of the Chinese Ministry of Health’s ethics committee, told reporters at the gene editing conference that lax regulations in China mean that scientists who break the rules often face no punishment, and think of the ministry as being “without teeth”.

The Atlantic

The announcement was shocking in many ways: He made it via YouTube video. He doesn’t yet have a scientific paper to back up his claims. He’s a relative outsider with little published gene-editing experience. His own university now claims it was kept in the dark about his incredibly controversial research. If you were trying to concoct a scenario that inflamed all the worst fears about Chinese science, could you do better than this?

Ich verstehe dabei den Aufschrei nicht so recht. Gab es bei den ersten genmodifizierten Affen in China 2014 ( Luo et al.) überhaupt eine Reaktion?

Fortune

Bioethicist Alta Charo of the University of Wisconsin raised an entirely different point. “The children were already at virtually no risk of contracting HIV because it was the father and not the mother who was infected,” she said at the conference.

CNBC

“This is criminally reckless and I unequivocally condemn the experiment,” said Hank Greely, director of the center for law and the biosciences at Stanford University … The near-term consequence of this kind of research could be “sick babies, disabled babies, dead babies,” said Greely. Some high-profile critics, including Harvard University’s well-known geneticist George Church, shared concerns with the AP about the method that the researchers in China used to edit the embryos, as it appears that the HIV infection can still occur if only certain cells were altered.

Tagesspiegel

Staats- und Parteichef Xi Jinping machte es zu einem der Ziele des Landes, auch im Bereich Biotechnologie weltweit führend zu werden. Im 13ten Fünfjahresplan (2016- 2020) wurde Genomforschung als ein Bereich identifiziert, der sich für Direktinvestitionen lohne. Seitdem fließen die Gelder in die Genforschung. Erst im Dezember 2017 wurde das „100 000-Genome-Projekt“ ins Leben gerufen, das das Erbgut genauso vieler Menschen sequenzieren soll. Dafür gibt Chinas Ministerium für Wissenschaft und Technologie über elf Milliarden Euro aus.

Wired Artikel

We said “don’t freak out,” when scientists first used Crispr to edit DNA in non-viable human embryos. When they tried it in embryos that could theoretically produce babies, we said “don’t panic.” Many years and years of boring bench science remain before anyone could even think about putting it near a woman’s uterus. Well, we might have been wrong. Permission to push the panic button granted.

Langsam wird damit auch der Ablauf seit dem letzten Wochenende klar, wenn man dem Wired Artikel glaubt. Danach fand zuerst MIT Technology Review am 25.11. einen Eintrag in dem chinesischen Register, dass ein solcher Versuch läuft. Eingetragen wurde am am 6.11.18, also mehr als 1 Jahr nach dem Beginn der Versuche am 7.3.2017, dem Tag der eingetragenen Genehmigung durch die Ethik Kommission. Das Dokument wurde aber laut Metadaten aber erst am 16.5.2017 erstellt.

PDF Metadaten Ethik

Wann der Registereintrag online ging, ist nicht klar, er wird aber offensichtlich immer wieder noch geändert, zuletzt am 26.11.18. Mit der Datierung des Excel Sheets (siehe unten), den vielen fehlgeschlagenen Versuchen und den weiteren 9 Monaten der Zwillingsschwangerschaft, hat He lange vor der Freistellung an der Universität im Februar 2018 an dem Trial gearbeitet.

Screenshot Registereintrag

Wohl auf den MIT Artikel hin, lädt He panikartig seine vorbereiteten Werbevideos hoch, da sein eigentlich geplanter Artikel zur Ethik nicht mehr vor der Hongkong Konferenz online gehen wird. MIT Technology Review am 27.11. hat  dazu weitere Hintergrundinformationen. He Jiankui beruft sich auf ein “US National Academies of Sciences, Engineering, and Medicine” Statement, das ähnlich wie der britische Nuffield Report Wissenschaft keine Vorschriften machen will.  Nach dem Registerdokument ist  “primary sponsor” die Southern University of Science in Shenzhen. Da das Trial aber erst so spät und mit falschen Daten eingetragen wurde, sind Zweifel auch an diesen Angaben berechtigt.

Überliefert aus Honkong ist das nervöse Auftreten von He.

He seemed shaky approaching the stage and nervous during the talk. “I think he was scared,” says Matthew Porteus, who researches gene editing at Stanford University in California and co-hosted a question-and-answer session with He after his presentation. Porteus attributed He’s nervous demeanor to either the legal pressures that He faces or to the prospect of addressing a critical audience of scientists and members of the media.

Kein Wunder, er muss ja auch ein völlig blödsinniges Vorgehen rechtfertigen.

At the summit, He revealed that one of the genetically modified twins will be resistant to HIV, because the gene edits removed both copies of her CCR5 gene. The other twin could still be susceptible to infection because the gene-editing process inadvertently left one copy of her CCR5 intact, he said. He’s decision to implant the second embryo drew strong criticism. “Why choose this embryo? It just doesn’t make sense scientifically,” said Seoul National University geneticist Jin-Soo Kim. During his talk, He said he had explained the situation to the parents and they decided they wanted to do it anyway.

Die erste Reaktion des Gene Summits in Hongkong fällt dann aber doch verblüffend nichtssagendend aus:

One such study, a 2017 report by the U.S. National Academies of Sciences, Engineering, and Medicine, concluded that clinical trials might be permitted after peer-reviewed preclinical research further clarifies the potential risks and benefits, only for compelling medical reasons in the absence of reasonable alternatives, and with maximum transparency and strict oversight. The report noted that such research should be approached with caution and with broad public input. It specified a regulatory framework that included ten recommended criteria and structures. … Whether the clinical protocols that resulted in the births in China conformed with the guidance in these studies remains to be determined.

was entsprechende Reaktionen provoziert

Twitter Screenshot

Damit gehe ich nun nicht mehr von einem Einzeltäter aus – seine Arbeitsgruppe an der Universität bestehend aus Jinzhou Qin, Shuo Song und Xiaoqing Zhou muss schliesslich auch an irgendetwas gearbeitet haben. Stellenausschreibungen auf seiner nicht mehr online verfügbaren Webseite beschreiben das Programm:

Multiple postdoctoral positions are available in Dr. Jiankui He’s laboratory in South University of Science and Technology of China (SUSTC). Dr. He is building up the Genome Center at SUSTC, with the most advanced high throughput sequencers such as Illumina Hiseq, Miseq, Ion Torrent and Roche 454. We are initiating an international collaborative study “The International Human Immunome Project”. The International Human Immunome Project aims to sequence the immune repertoire of 10,000 patients and identify disease-specific T or B cell receptor sequences for 100 diseases such as cancers, autoimmune diseases, infectious diseases and other immune related diseases.
Position A:candidates should have research experience in immunology, preferably, B cells and T cells.
Position B: candidates should have research experience in cancer biology, preferably, tumor immunology.
Position C: candidates should have extensive research experience in high throughput sequencing.
The salary for these positions is 150,000-200,000 RMB per year. Contract is renewable. Candidates has previous postdoc research experience are able to consider for research scientist position.

Von der Crispr Szene vielleicht aktuell sicher nicht gewollt, in China aber eher akzeptabel, kann sich He Jiankui in der Tat auf diverse einschlägige Dokumente berufen. Und er war nicht ganz der Aussenseiter wie er jetzt gerade hingestellt wird und hat 2017 in Cold Spring Harbor gesprochen, so STAT

He’s career trajectory highlights a few salient facts: His scientific background is wide-ranging, but lacking in deep expertise in CRISPR and embryology. Public records indicate that he is just 34 years old, an age when many top researchers are just opening up their first labs.
He, who appears to have been born and raised in China, earned his undergraduate degree in physics from the University of Science and Technology of China in 2006. He then moved to Texas to earn his Ph.D., in biophysics, at Rice University in Houston; his adviser there, the bioengineering professor Michael Deem, would later collaborate with him on the CRISPR’d embryos project.
After graduating in 2010, He spent about a year doing his postdoc in the lab of Stanford bioengineer Stephen Quake. It was there that He learned about single-molecule sequencing ― a then-revolutionary method of sequencing single DNA molecules without first having to copy them using polymerase chain reaction, according to a 2015 story in the publication Bio-IT World.
He moved back to China around 2012. It’s not clear why he decided to return home, but a few factors may have come into play. He wanted to spin off companies from his academic research back in China, according to Bio-IT World. And financial incentives may have contributed to his decision: He moved back to China as part of the Thousand Talents program, an initiative in which the Chinese government has offered incentives to try to bring back its best and brightest scientists and entrepreneurs who did their training in the U.S.

Ethik wird zur Akzeptanzbeschaffung degradiert, zumal nun auch heute sein länger geplanter Artikel in einem predatory journal online ging (Liebert, Volume 1, Number 6, “authors are asked to fill out a short open access order form. You can pay by credit card”). Hier wiederholt He Jiankui (zusammen mit  Ryan Ferrell,  Chen Yuanlin, Qin Jinzhou und Chen Yangran) seine selbstkonstruierten Regeln, wohl ahnend, dass die Akzeptanzgering sein wird.

Interessenskonflikte: keine. Dabei kam heute heraus, dass He seit 2015 eine eigene Firma betreibt: directgenomics.com (zusammen Qin Yan, Liangjin Ye, Zefei Jiang, Zhiliang Zhou, Luyang Zhao). Über weitere Firmenbeteiligungen wird spekuliert. Die Sequenziertechnik ist schwer einzuschätzen, ein Einzelmolekülverfahren, rebranded oder Eigenentwicklung? Ich hoffe, er hat die Embryos nicht damit sequenziert, Details auf nature biotechnology review.

Sequence providers, potential customers, are in wait-and-watch mode. Ruiqiang Li, CEO of the Beijing-based genomics services provider Novogene, which has one of the few Illumina HiSeq X Ten whole genome sequencing platforms in China, says that by avoiding PCR amplification, single-molecule sequencing avoids bias, but a high error rate has proved a challenge. “It’s a very important step forward. But we see that Helicos failed, and PacBio and Oxford Nanopore have very high sequencing error rate,” says Li.

Ich vermute mal , er hat bei B.G.I. Shenzhen sequenzieren lassen.

Bei den Antragsunterlagen habe ich zudem ein Excel Sheet in dem Register gefunden, das lauf Metadaten vom 5.6.2015 stammt, also fast 2 Jahre älter als der bisher angenommene Versuchsbeginn am 7.3.2017 (2012 kam er nach China zurück).

Excel Metadaten

Tabelle 1 fehlt in dem Excel Sheet. In Tabelle 2 findet sich für beide Embryos (?) die Zusammenfassung einer genomweiten (?) Auswertung. Fragezeichen deshalb, weil es  extrem wenig Einträge aufweist.

Beide Kinder haben wohl genetisch das Risiko eines Glutaryl-CoA-Dehydrogenase-Mangel, eine autosomal-rezessiv vererbte neurometabolische Störung mit enzephalopathischen Krisen durch Striatum-Läsionen und schwerer dystonisch-dyskinetischer Bewegungsstörung. Neugeborene sind meist symptomfrei, haben aber in 75% der Fälle eine Makrozephalie. Wissen das die Eltern von Lulu und Nana oder weiss das nur das Internet? Ich glaube nicht, dass die Variante rs8012 de novo aufgetreten ist. In zwei unabhängigen Zygoten dieselbe Mutation? rs8012 ist signifikant mit Glutaroylcarnitin Spiegel assoziert (Shin 2014) führt zu dem Aminoaustausch GLN417ARG, den ich bei OMIM nicht finde (dort gibt es VAL400MET, ARG402TRP, THR416ILE, ALA421VAL). Nach einer ägyptischen Arbeit liegt der SNP rs8012  im 3’UTR und ist wohl eher geringer phänotypisch wirksam, als die anderen GCDH Mutationen.

Es sieht nach dem Excel Sheet so aus, als hätte He Jiankui der schwangeren Mutter in der 12., 19. und  24. Woche Blut abgenommen, um cfDNA (zellfreie fetale DNA) zu sequenzieren. Das war dann wohl die ganze medizinische Kontrolle während der Schwangerschaft? Keine Amniozentese?

Die erste Sequenz “CAGAATTTATACCCACACTAGGG”auf chr1 ist off target, mir ist nicht klar, was sie an der Stelle soll. Die zweite “CAGAATTGATACTGACTGTATGG” mit einem 6 Basen Offset auf chr3 ist im CCR5 Locus und taucht ansonsten nur noch in einem chinesischen Paper auf (“Inhibition of HIV-1 infection of primary CD4+ T cells by gene editing of CCR5 using adenovirus-delivered CRISPR/Cas9” sowie in einem PNAS Artikel (“Human genetic variation alters CRISPR-Cas9 on- and off-targeting specificity at therapeutically implicated loci”). Das waren also seine “Vorversuche” – einfach etwas aus der Literatur abgeschrieben.

Ärzteblatt

Eine unabhängige Bestätigung für Hes Behauptung gab es zunächst nicht. Der Wissenschaftler betonte aber, er habe Forschungsunterlagen bei einer Fachzeitschrift eingereicht. Gleichzeitig gab er an, seine Forschung sei unerwartet an die Öffent­lichkeit gedrungen. Dies ist umso erstaunlicher, als He die Nachricht in einer Ansprache über Youtube selbst verbreitet hatte – kurz vor Beginn des Kongresses.
Dort waren die Versuche das dominierende Thema. „He hat in einer großen Halle der Universität gesprochen, und die war bis auf den letzten Platz voll“, sagte der Biochemiker Ernst-Ludwig Winnacker, der an dem Kongress teilnahm. „Er machte einen gut vorbereiteten Eindruck und trat sehr selbstbewusst auf.“ Bei dem Vortrag wiederholte He, er habe mehrere kinderlose Paare aus gesunder Mutter und HIV-infiziertem Vater dazu gebracht, bei den Versuchen mitzumachen. Am Ende habe eines der Paare Zwillinge bekommen. „Auf diesen speziellen Fall bin ich wirklich stolz“, sagte er.

Wired

It’s too soon to say whether He’s stunt will bring him fame or just infamy. He’s still scheduled to speak at the human genome editing summit on Wednesday and Thursday. And China’s central government in Beijing has yet to come down one way or another. Condemnation would make He a rogue and a scientific outcast. Anything else opens the door for a Crispr IVF cottage industry to emerge in China and potentially elsewhere.

Donnerstag 29.11.18

AP

First, sperm was “washed” to separate it from semen, the fluid where HIV can lurk. A single sperm was placed into a single egg to create an embryo. Then the gene editing tool was added.
When the embryos were 3 to 5 days old, a few cells were removed and checked for editing. Couples could choose whether to use edited or unedited embryos for pregnancy attempts. In all, 16 of 22 embryos were edited, and 11 embryos were used in six implant attempts before the twin pregnancy was achieved, He said.
Tests suggest that one twin had both copies of the intended gene altered and the other twin had just one altered, with no evidence of harm to other genes, He said.

SZ

Chinesische Medien berichten, He habe für seine Versuche keine Genehmigung eingeholt. Die chinesische Regierung hat eine “unverzügliche Untersuchung” angeordnet. Der Vize-Minister für Wissenschaft und Technologie, Xu Nanping, bezeichnete das Experiment als illegal. Die Nationale Gesundheitskommission teilte am Dienstag in Peking mit, man prüfe, ob der Fall mit den Gesetzen zum verantwortlichen Umgang mit der Gesundheit der Menschen übereinstimme. He sagte in Hongkong, außerhalb seines Teams habe er sich nur mit vier Personen abgesprochen, darunter ein US-Forscher und ein Mitglied der Chinesischen Akademie der Wissenschaften.

Nature

Many scientists faulted He for a lack of transparency and the seemingly cavalier nature in which he embarked on such a landmark, and potentially risky, project.

NYT

China excels in most kinds of technology, but when it comes to gene editing and designer babies, it has an extra advantage: a population that has been conditioned to manipulating reproduction as a tool for progress. I’m referring, of course, to the three decades of family-planning rules known as the one-child policy.
Behind the science of what’s doable is the mind-set of what’s desirable. China’s unprecedented reproductive experiment, officially ended in 2015 although many restrictions continue, has created a people accustomed — in many cases, forcibly so — to controlling the number and gender of their offspring.

MIT Technology Review

These two children are the guinea pigs. They will go through their whole maturing process having not understood the risks ahead of time,” said Liu Ying of Peking University’s Institute of Molecular Medicine.

Science

Ethics aside, does the CRISPR baby experiment make scientific sense? … Is it possible that CRISPR led to mutations that didn’t cripple CCR5? Yes. Mutated genes sometimes still produce functional proteins.

futurezone

Die chinesische Regierung hat dem Forscher He Jiankui und seinen Mitarbeitern weitere Forschungsaktivitäten untersagt … Die von He berichtete Erzeugung genmanipulierter Babys sei „äußerst abscheulicher Natur“ und verletze chinesische Gesetze und die wissenschaftliche Ethik, sagte der stellvertretende Wissenschaftsminister Xu Nanping der staatlichen Nachrichtenagentur Xinhua am Donnerstag. Zuvor hatten sich schon die Nationale Gesundheitskommission des Landes und die Chinesische Gesellschaft für Wissenschaft und Technologie (CAST) von He distanziert.

Stat

William Hurlbut first met He (whom he calls JK) in January 2017, at a workshop that Hurlbut and CRISPR pioneer Jennifer Doudna of the University of California, Berkeley, held at Berkeley to discuss ways to educate and engage the public on issues raised by human genome editing. The Chinese scientist did not participate actively in group discussions (his English is somewhat halting). “I have no clear impression of what his views were on these crucial points,” said a leading American expert on science policy who asked not to be named because the workshop was private. He nevertheless left an impression of “great smoothness,” this scholar said, adding, “He and his more senior Chinese colleague clearly did not have deep misgivings about plugging ahead with gene editing, and I sensed no exposure to the sorts of ethical debates our guys are routinely involved in.”

Das spricht alles gegen einen Einzelgänger. He Jiankui räumt ein, vier Personen hätten Bescheid gewusst, da gehört vermutlich auch Michael W. Deem, sein Doktorvater dazu.

Freitag 30.11.18
CNN

“The simple fact that he was directly involved in trying to get consent from the patients is a huge problem,” said Robin Lovell-Badge, head of the Laboratory of Stem Cell Biology and Developmental Genetics at the Francis Crick Institute, who moderated the discussion with He. “You should never do that. You should have an independent third party who can properly explain the risks and the benefits.”

Wayback hat zum Glück eine Kopie der Webseite von He Jiankui gezogen, die mittlerweile nicht mehr online ist.

Ein Wikipedia Eintrag erscheint zu Lulu und Nana.

Das NIH will nun doch Keimbahnänderungen regulieren.

While Collins said in a statement issued Wednesday that the revelation of CRISPR babies highlighted the need for a “binding international consensus” on germline gene editing, he acknowledged there is little consensus as to how governments should translate such scientific opinions into law. It is “not entirely obvious,” Collins said, that the United Nations is the international body best equipped to police gene-editing research either.

Das Organisationskommitee der Konferenz in Hongkong schliesst sich den weltweiten Protesten an.

Report of Clinical Use of Germline Editing
At this summit we heard an unexpected and deeply disturbing claim that human embryos had been edited and implanted, resulting in a pregnancy and the birth of twins. We recommend an independent assessment to verify this claim and to ascertain whether the claimed DNA modifications have occurred. Even if the modifications are verified, the procedure was irresponsible and failed to conform with international norms. Its flaws include an inadequate medical indication, a poorly designed study protocol, a failure to meet ethical standards for protecting the welfare of research subjects, and a lack of transparency in the development, review, and conduct of the clinical procedures.
An Ongoing International Forum
The organizing committee calls for an ongoing international forum to foster broad public dialogue, develop strategies for increasing equitable access to meet the needs of underserved populations, speed the development of regulatory science, provide a clearinghouse for information about governance options, contribute to the development of common regulatory standards, and enhance coordination of research and clinical applications through an international registry of planned and ongoing experiments.

Guardian

The Southern University of Science and Technology in Shenzhen, where He is an associate professor, has said it had no knowledge of his research.
The scientist has said his project was approved by an ethics committee at Harmonicare Shenzhen women and children’s hospital, which has also denied any involvement.

Aktienkurse diese Woche

Bloomberg Crispr Aktien steigen leicht. Im Internet gibt es immer mehr “crispr baby comics”.

Ich denke, man sollte He weder heroisieren (“auch Jenner musste Risiken bei der Pockenimpfung eingehen”) noch dämonisieren (“200 Jahre Frankenstein”, “21 Jahre Gattaca”) sondern primär seine dreiste Vorgehensweise konstatieren, sich überall an Methoden zu bedienen, keine Vorversuche zu machen und zu publizieren, und ohne Skrupel Menschenversuche ohne deren Einverständnis zu machen. Die Aussagen seines Vaters

He was always first in primary school, middle school, university and after that. He was never second. Always first,” his father told Beijing News.

Samstag, 1.12.2018

Bisher findet nur ein einziger Genetiker He’s Versuche richtig: George Church, wer hat es auch anders erwartet.

I’d just as well not hang myself out to dry with someone I barely know, but I feel an obligation to be balanced about it. I’m sitting in the middle and everyone else is so extreme that it makes me look like his buddy. He’s just an acquaintance. But it seems like a bullying situation to me. The most serious thing I’ve heard is that he didn’t do the paperwork right.

Es geht hier aber eigentlich nicht um irgendwelches Papier, sondern um Menschen. Es scheint, wir müssen in der Genetik viele profilierungssüchtige Mitmenschen aushalten wie  Craig Venter  oder James Watson, selbst Verbrecher wie William French Anderson, Hwang Woo-suk oder Severini Antinori.

Vox

 

That’s because there are real limits to what CRISPR can do, at least right now. Scientists have recently learned that the approach to gene editing can inadvertently wipe out and rearrange large swaths of DNA in ways that may imperil human health. That follows recent studies showing that CRISPR-edited cells can inadvertently trigger cancer.

Keine Reaktion bis jetzt von Louise Brown

Screenshot Website

NYPost

…if we are separated into the enhanced and unenhanced, respect for the dignity of every human life will be diminished. So will personal responsibility. If we don’t make it in life because we are unenhanced, it’s not our fault. And if we do because we are enhanced, we don’t get the credit. … Then there is the threat to women’s equality. If genetic engineering can offer the promise of eliminating disease, it will also allow parents to choose the sex of their child. That could lead to greater sex discrimination. … It will also lead to an explosion in the number of discarded children. For every child born via in vitro fertilization, there are multiple fetuses which are created but never used. Today, the Department of Health and Human Services reports, there are more than 600,000 cryogenically frozen embryos in the US. If genetic engineering through in vitro fertilization becomes common, that number will skyrocket, sparking a profound moral crisis.

Die FAZ hat nun auch den “Ethik”-Artikel zu dem unsäglichen “Trumpismus”

Eine Ethik-Lehrstunde für das Establishment, vom Tabubrecher höchstselbst. Kein Witz! Man glaubt es nicht. Kann es wirklich sein, dass Dr. He, jener Wissenschaftler, der am Montag nach allen Regeln der PR-Kunst und ohne jede Rücksicht auf Standesregeln die Geburt von genmanipulierten Zwillingen als gezielten Tabubruch inszeniert hat und seinerseits jeden Berufsethos hat vermissen lassen? Ist es also möglich, dass ebendieser Gen-Guerillero der weltweiten Wissenschaftltergemeinde ernsthaft eine Anleitung für ethisches Handeln in der Reproduktionsmedizin vorlegt?

Kommentar unter dem FAZ Artikel

Empörung vorne – stille Freude hinten
Es wundert mich nicht, dass genau so ein Eingriff jetzt gemacht wurde, sobald die technischen Voraussetzungen dafür geschaffen sind. Freiwillige Einschränkungen oder Unterlassungen aus moralischen, ethischen usw Gründen funktionieren in der Menschheit eben leider nicht.

Twitter Hashtags, ab sofort hat He auch einen Fake Account

leider am nächsten Tag auch schon wieder gelöscht.

##crisprbabies #scicomm #crispr #geneediting #HeJiankui #kingkongvogel #LucidQuest #followthepatient #genetherapy #apocalypse #baby #controversy #Harvard #University #science #sciencemm #editing #dna #biology #neuroscience #molecularbiology #cas9 #crisprcas9 #Bio ##dream #practice #Russia #Geneticsschool #genetics #artificialintelligence #virtualreality #augmentedreality #mixedreality #medicalscience #bigdata

He Jiankui (oder ein Mitarbeiter) registriert ein weiteres Trial . Da komme ich mir vor wie 9/11 wo niemand wusste, wieviel Flugzeuge denn nun entführt wurden.

Gene therapy is to replace or correct the defective genes of patients by genetic engineering technology, so as to achieve the goal of eradicating hereditary diseases. In 2017, the first gene therapy was approved in the United States, and the first human genome editing clinical trial started. In this study, we will use the most popular CRISPR/Cas9 gene editing technology and its derivative single base mutation technology to carry out exploratory experiments on the abandoned human embryo samples (mainly 3PN samples) from the assisted reproduction process. The donors of the human embryos are consent informed. At present, we have selected the CCR5 and PCSK9 genes as the research targets. Through this study, point mutations in diseases are accurately repaired to prevent the disease, or to regulate the expression of the pathogenic gene, so as to cure the related diseases. At the same time, the related samples will be sequenced in depth, and the related genes can be analyzed to reveal the mechanism of infertility to improve the pregnancy outcome of infertility.

Practical Ethics Blog

The basic principles of research ethics are:
Risk should be reasonable (See Savulescu & Hope, The Ethics of Research). This includes that risks are minimized and that there are proportionate benefits. There would have been less expected harm if embryos with lethal disorders were used. Any child produced would stand to derive a very significant benefit: having their life saved. Lulu and Nana derive no direct benefit: HIV can be prevented in numerous ways, including by protected sexual intercourse. Yet they were exposed to significant risk of off target mutations and cancer. The benefits to them are not proportionate to the risk.
Consent should be obtained. Clearly embryos cannot consent. Research on incompetent participants can be ethical if it is minimal risk or the benefits are proportional to the risks. This would only be the case if the embryo had a lethal disorder, and not when the embryo and future child only stands to be harmed with no direct benefit.

Sonntag 2.12.2018

Google Photos, nun endlich mit der Versuchsanordnung

Warum der Versuch, unethisch und wissenschaftlich dubios ist:

Twitter Screenshot

Damit verstehe ich ich die 1# OT Sequenz des Excel Sheets. In der Tat sehr weit off target mit geringem Konsensus, zum Glück aber cold spot.

Lalign target und off target

Nun auch noch mehr Sequenzdaten als in dem Excelsheet

Twitter Screenshot

Irgendetwas stimmt da nicht, das trifft nicht genau die delta 32 Mutation. Da das Register nicht mehr online ist, hier das Excel 65bc3ccdc7284a2fab1e1e6d12bb5d03.xlsx.

Die Arbeit hat sich gerade aber schon Sean Ryder gemacht:

Schwierig zu sagen was wohl die Mutation funktionell macht. Delta32 verliert jedenfalls über 137 Aminosäuren. Im 3D view sieht Delat32 massiv aus, nicht zuletzt durch den Frameshift. Lulu wird wohl nicht HIV geschützt sein, allenfalls Nana, wer weiss das schon? Genau wie Sean Ryder sagte

what really bothers me. The children are test subjects for protein variants that haven’t been vetted in animals

(vermutlich kommt die Grundidee von einem älteren Science Paper über somatische Gentherapie). Die Technik ist im übrigen sehr fehleranfällig, es gibt ein neues Paper auf biorxiv.org, nachdem ich 10 OTs erwarten würde, er hat aber nur 1 gefunden.

We applied GOTI to both the CRISPR-Cas9 and base editing (BE3) systems by editing one blastomere of the two-cell mouse embryo and then compared whole genome sequences of progeny-cell populations at E14.5 stage. Sequence analysis of edited and non-edited cell progenies showed that undesired off-target single nucleotide variants (SNVs) are rare (average 10.5) in CRISPR-edited mouse embryos, with a frequency close to the spontaneous mutation rate. By contrast, BE3 editing induced over 20-fold higher SNVs (average 283), raising the concern of using base-editing approaches for biomedical application.

Dazu kannte er auch nicht den zell-spezischen Bias jeder gRNA.

Each gRNA has an individual cell-line-dependent bias toward particular outcomes.

Damit kommt die Stunde der Kommentatoren. Die einen wollen dass alles so weiter geht (ZEIT)

Diese Zäsur darf nicht das Ende von Crispr sein
Kamen genetisch veränderte Babys auf die Welt? Egal, ob die Nachricht von Versuchen an Menschen stimmt – sie bringt eine Gentechnik in Verruf, die Leben retten kann.

MIT Technology Review

Despite CRISPR baby controversy, Harvard University will begin gene-editing sperm
Even as a furious debate broke out in China over gene-edited babies, some scientists in the US are also hoping to improve tomorrow’s children.

Die TAZ mit einem Boyle Interview

Wovor haben wir am meisten Angst? Das Experiment in China ist bislang nicht mal bewiesen – und die Empörung riesig.
Wir sind Produkte der Natur. Wir leben auf einem mysteriösen Planeten und kennen die wesentlichen Antworten auf unsere Existenzfragen nicht: Warum? Was ist passiert? Wo kommt es her, was bedeutet es? Die gesamte Menschheitsgeschichte und Evolution wird durch etwas wie die Crispr-Technologie negiert. Menschliche Designerbabys: Damit beginnen wir eine neue evolutionäre Zeit

Die hier bisher geschilderte Version des Zeitablaufes scheint zu stimmen, siehe Quartz

He Jiankui didn’t wake up on Sunday expecting his world to change. He’d authored a paper that was to be published on Monday, and planned to speak about his work at the most important conference in his field of study on Wednesday. And he’d spoken with a reporter from the Associated Press (AP), so he was likely aware that sometime before his speaking engagement, the AP might publish a blockbuster report about his great scientific achievement. He knew international attention was coming for him, and he had a plan.
Then Antonio Regalado, biomedicine editor at MIT Technology Review, ruined it. On a recent trip to China, Regalado heard rumors that He’s lab at the Southern University of Science and Technology in Shenzhen was undertaking research on gene-editing human fetuses. A simple Google search using the terms “He Jiankui” and “CCR5” (the gene being edited) led him to clinical-trial registration documents that revealed He had recruited couples for a clinical trial to create the world’s first gene-edited baby. Regalado called He on Sunday morning (Nov. 25) to ask whether the trial had led to the birth of any gene-edited babies. But He declined to comment.

Vielleicht einmal zwischendurch gesagt: Ich habe mit mehreren chinesischen Kollegen Kontakt, die alle entsetzt sind. Hier kommt nun auch noch die übersetzte Version des Ethikantrages von www.chictr.org.cn/ Das Hospital, das in diesem Antrag genannt wird, sagt allerdings, die Unterschriften auf dem Original seien gefälscht.


Das hört sich schon nach Grössenwahn an

in order to stand out in the increasingly competitive applications of gene-editing techniques in the whole world. This will be revolutionary research that surpasses the 2010 Nobel Prize winning research in in-vitro fertilization, and it will bring hope to the treatment of countless major genetic diseases.

ist allerdings nicht so harmloser Unsinn wie auf der (nicht mehr verfügbaren Website) dass er durch Umwetlnoxen induzierte Mutationen heilen will.

Paul Knoepfler fragt

An underappreciated part of He-#CRISPR story is that there are effective CCR5 inhibitor drugs out there including Maraviroc which is listed in >150 clinical trials. If you can drug an allele/protein, why take risks of Indel-focused germline mutation?

Sean Ryder (von dem die exzellente Annotation stammt, die hundertfach retweetet wurde)

#CRISPRbabies The ClinVar database lists two frameshift mutations in CCR5, of these only Delta32 is annotated as protective. The 1000 genomes project identified 10 more, and three in frame deletions. Table and link to ALL variations here:

Für das RNA design hat er angeblich Synthego verwandt, das jetzt allerdings das Protospacer Adjacent Motif (PAM) etwas früher legt. Aber Designidee ist dabei ein knockout, während He wohl die Delta32 Mutation imitieren wollte.

 

Montag 3.12.2018

Es haben nun doch viel mehr Bescheid gewusst, so AP heute

But three Stanford scientists — Hurlbut, Porteus and He’s former fellowship adviser, Stephen Quake — had extensive contact with him over the last few years. They and other scientists knew or strongly suspected that He intended to try to make genetically edited babies…
In a draft article about the gene-edited twin girls, which He planned to submit to journals, he thanked UC Berkeley biophysicist Mark DeWitt for “editing the manuscript.” …
Michael Deem, a bioengineering professor at Rice University and He’s doctoral degree adviser, said he had worked with He since the scientist returned to China around 2012, and that he sits on the advisory boards and holds “a small stake” in He’s two genetics companies in Shenzhen. Deem defended He’s actions, saying the research team did earlier experiments on animals.

Das chinesische Ethik Dokument aus dem Register weicht dabei von dem englischen Dokument auf der Webseite ab. Ausserdem gibt es Diskrepanzen zwischen der Versuchsbeschreibung im Register, der Webseite, dem Hongkong Vortrag, den Youtube Videos sowie den Aussagen Dritter. Es wird Wochen brauchen für die jeweiligen Kommissionen, die Fakten zu sortieren, vor allem wenn He auch noch absichtlich falsche Darstellungen produziert hat.

Das Youtube Video “About Lulu and Nana” errreicht mittlerweile Rekordzahlen, im Augenblick über 276.000 Aufrufen  und über 2.000  Kommentare.

You just opened Pandora’s box on behalf of the entire human race.

West Nile Virus laut CDC Details

About 1 in 5 people who are infected develop a fever and other symptoms. About 1 out of 150 infected people develop a serious, sometimes fatal, illness.

Es gibt auch in China – Erkrankungsfälle laut Global Ecology and Epidemiology of West Nile Virus (Shenzhen liegt direkt bei Hongkong).

Eigentlich ist dieses Projekt wissenschaftlicher Hochverrat, das die Genetik auf Jahre hinaus in Verruf bringt.  Oslo wird auch 2019  den Nobelpreis nicht an Doudna & Charpentier vergeben können.

Es ist aber auch eine ethischer Katastrophe wenn den Eltern nach dem archivierten (und mittlerweile nicht mehr verfügbaren Protokoll Second-informed-consent-English.pdf )

  • 50,000 Yuan für den Versuch angeboten werden plus 200 Yuan/Tag für die 28 Tage dauernde Untersuchungen nach der Geburt
  • ihnen Anonymität versprochen wird (die nicht zu halten sein wird)
  • die Gene von “Nordeuropäern” versprochen werden
  • wahrscheinlicher HIV Schutz
  • ohne Risiko von “off-targets”
  • das Risiko der Fehlbildungen zu Lasten der Eltern geht
  • die Eltern nicht mit der Presse reden dürfen
  • alle Fotorechte He Jiankui gehören

E sieht immer mehr danach aus, dass er -gewollt oder nicht gewollt- eine finanzielle Notlage der HIV Paare ausgenutzt hat, die sich ansonsten “sperm washing” nicht leisten können. Wie aber sonst hätten sie Kinder bekommen sollen? So legt es jedenfalls das Sanlian Life Week Dokument  (weiter unten) nahe.

Zheng Xiao [pseudonym] had considered going to Thailand for sperm washing. But from what he found out online, it would cost hundreds of thousands of dollars, and the in-vitro fertilization process would cost hundreds of thousands more. He and his wife lived in a small county, worked ordinary jobs, and could not dream of affording it. So when he saw the news of He Jiankui recruiting for his study, Zheng Xiao felt as if a small sliver of light appeared before his eyes.

Und was die amerikanische Beteiligung angeht: Sie erinnert mich fatal an Scott Weiss und Xu Xiping  von der Harvard University der damals die  Anhui Studie nicht auswerten durfte, weil den Probanden falsche Tatsachen vorgespiegelt wurden ( Quelle ).

DLF

Jürgen Habermas hat Arendts Begriff vor einigen Jahren aufgegriffen, um zu begründen, worin die grundsätzliche Gefahr menschlicher Eingriffe in das Erbgut Neugeborener liege. Ein Mensch, der erkennen müsse, dass Teile seines Erbgutes nach den Präferenzen anderer programmiert wurden, müsse seine Natalität und damit seine Würde als eingeschränkt erleben. Er könne sich nicht mehr als voraussetzungslosen Neuanfang verstehen, und damit nicht mehr als Autor des eigenen Lebens.

Dienstag 4.12.2018

Die Rice Universität distanziert sich von Deem.

Mich erinnert der Fall von Michael Deem & He Jiankui sehr an Scott Weiss & Xu Xiping Washington Post 2000

Screenshot

Economist

It may even be that editing will one day be used on embryos to enhance genomes (to make people cleverer, say), rather than to cure disease. But that requires regulators, policymakers, scientists and civil society to think through deep ethical questions. … Such debate was always going to be needed. Now it is urgent.

Paul Knopfler fordert ein 3 Jahres Moratorium in STAT

I watched a livestream of parts of that meeting. I was surprised that He was scheduled to speak at it — twice. One other talk really shook me: Dr. George Daley, dean of Harvard Medical School and one of the summit organizers, made the case in favor of human germline editing in the not too distant future and vaguely characterized He’s effort as just a “misstep.” … But the organizers of the 2018 meeting diluted their statement’s impact by making the case for a path toward future human germline gene editing if strict criteria are met. This path, combined with the earlier words of Daley and other speakers at the meeting arguing in favor of moving toward such a goal, yield a mixed message. … Unlike the meeting organizers, I favor a low-risk, temporary, three-year moratorium on implantation of gene-edited human embryos to make genetically modified babies.

The Atlantic hat die beste Einschätzung von dem was bisher passiert ist

The alleged creation of the world’s first gene-edited infants was full of technical errors and ethical blunders. Here are the 15 most damning details.
1. He didn’t address an unmet medical need
2. The actual editing wasn’t executed well
3. It’s not clear what those new mutations will do
4. There were problems with informed consent
5. He operated under a cloak of secrecy…
6. … organized a slick PR campaign
7. A few people knew about He’s intentions but failed to stop him
8. He acted in contravention of global consensus
9. He acted in contravention of his own stated ethical views
10. He sought ethical advice and ignored it
11. There is no way to tell whether He’s work did any good
12. He has doubled down
13. Scientific academies have prevaricated
14. A leading geneticist came to He’s defense
15. This could easily happen again

Sanlian Life Week (cited here)

Although He Jiankui and his team told Zheng Xiao that their technology was “sufficiently safe,” Zheng Xiao nonetheless decided to opt out of He Jiankui’s gene-editing project before signing the consent form

Und ich wüsste  gerne in dem Zusammenhang – welches Journal das Manuskript von He zum Review hat. Wer sind die Reviewer?

Das Medienecho wird  geringer, es scheint in Mode zu kommen, Listen aufzustellen. So auch Nature

Is He Jiankui in trouble?
Are He’s claims accurate?
When will there be another gene-edited human?
Will He’s revelations hamper ethical efforts to do germline editing?
How will scientists ensure better oversight of germline editing in future?

Ansonsten geht es heute um die Frage welches Gen Hi Jiankui wohl bei der zweiten Familie mutiert hat (mutiert ist korrekt, editiert wäre Schönfärberei) STAT hat einen Tipp

The email landed out of the blue. As Dr. Kiran Musunuru was scrolling through his inbox about a year ago, he found a message from a scientist identifying himself as a graduate student at Southern University of Science and Technology in China [Feifei Cheng]. It explained that the lab where the student worked had used CRISPR, the revolutionary genome editing tool, to disable a gene called PCSK9 in human embryos.

Nun, Cholesterin wäre auch ein Designtarget, das wissen aber doch schon seit dem zweiten Registereintrag.
Ich hatte gehofft, es würde nicht soweit kommen, aber jetzt ist von dem “China’s Frankenstein” die Rede und zwar von Newsweek.

The scientist was brought back to Shenzhen by the university’s president, Chen Shiyi, Apple Daily reported. Chen is under house arrest on campus, the report said, adding that there were security guards on the university grounds. However, a spokeswoman for the Shenzhen-based Southern University of Science and Technology batted away reports of police arrests, telling the South China Morning Post, “Right now nobody’s information is accurate, only the official channels are.

Die WHO äussert sich ()

Der Chef der Welt​gesund​heits​organi​sation (WHO) hat angesichts der angeblich genmanipulierten Babys in China vor den unbeabsichtigten Konsequenzen solcher Eingriffe gewarnt. Richtlinien sollen erarbeitet werden, um Rahmenbedingungen für mögliche Einsatzgebiete der Methode vorzugeben.
Generaldirektor Tedros Adhanom Ghebreyesus will die Genom-Manipulationen an Keimzellen nicht von vornher- ein als Therapie bei Krankheiten ausschließen. Die WHO berufe jetzt ein Expertengremium ein, um alle Aspekte der umstrittenen Technik zu untersuchen, sagte der WHO-Generalsekretär am Montag in Genf. „So etwas kann nicht einfach ohne klare Richtlinien gemacht werden.“ Genom-Editierung werfe ethische, soziale und Sicher- heitsfragen auf, sagte Tedros.

Jetzt ist auch noch das Werkzeug schuld / Wired.

The documents named Massachusetts-based Thermo Fisher Scientific as the supplier of Cas9—the bacterial protein that clamps onto DNA and delivers a double-stranded slice—and Bay Area startup Synthego as the maker of its synthetic guide RNA. If gene editing were a butcher shop, Thermo Fisher would craft the knives and Synthego would instruct on which cuts to make.

Aber Spass beiseite vielleicht kann Synthego CEO Paul Dabrowski mal sagen was Hi bisher alles bei ihm bestellt hat? Kunden die CCR5 bestellten, bestellten auch PCSK9?

Deem wird weiter verhört (CNN).

Ein Dokumentation über Christiaan Barnard 1967

International hatten sich in den Sechzigern zahlreiche Teams auf Herztransplantationen vorbereitet, besonders in den USA. Zaudern ließ sie eine mögliche Mordanklage, wenn sie einem Patienten das noch schlagende Herz entnommen hätten. Barnard preschte vor und stach alle medizinischen Rivalen aus. Zuvor war der ehrgeizige 45-Jährige praktisch unbekannt, über Nacht wurde er zum Weltstar … Erst 1968 definierte eine Kommission der Harvard Medical School Menschen als tot, wenn sie in einem irreversiblen Koma liegen und das Gehirn bereits zerstört ist.

Donnerstag 6.12.2018

Das Nuffield Council distanziert sich nun auch, es wurde auch Zeit

The possibilities raised by heritable genome editing could have significant implications for individuals and for all of society. We do not know enough about the safety of these procedures or welfare implications. It’s crucial that action is taken now to support research on safety, facilitate public debate, and put in place appropriate governance.
In July, the Nuffield Council on Bioethics published a report on the ethical and social issues raised by heritable genome editing interventions. We concluded that their use could be morally permissible in some circumstances. These circumstances do not, however, exist at present, anywhere. In our report we have discussed what these circumstances might be, but it is now for the wider society to agree them, and to define what governance measures should apply.
We recommended that any use of genome editing interventions should be guided by two overarching principles: they must be intended to secure, and be consistent with, the welfare of the future person; and they should not increase disadvantage, discrimination or division in society. More work needs to be done to establish whether these principles can be met.
Pete Mills, Assistant Director, added:
“Coming on the eve of the second international summit on genome editing, this announcement looks like a cynical attempt to seize headlines. If the claims are true, it is a premature, inexplicable and possibly reckless intervention that may threaten the responsible development of future applications of genome editing.”

Die Bild Schlagzeile heute

ER WILL BABYS GENMANIPULIERT HABEN
Chinesischer Wissenschaftler wird vermisst

bisher gab es nur die verunglückte Formulierung von “Gott gespielt“.

Das ist ja wohl blasphemisch. Gott würfelt nicht. Und Gott spielt nicht. Die chinesische Nachrichtensperre scheint im übrigen zu greifen. Mit etwas Abstand nun auch zwei Pulitzer Preisträgerinnen der NYT

 

Most importantly, said Dr. Kiran Musunuru, a geneticist at the University of Pennsylvania who reviewed the data, “there’s clear evidence of mosaicism” in the edited embryos of both twins. “I was so furious,” Dr. Musunuru said. “This would have been disturbing anyway — gene-edited babies. It made it a hundred times worse knowing that he had totally mosaic embryos. It’s as if you took the embryos and dipped them in acid and said ‘You know what, I’m just going to go ahead with the implantation anyway.’ It’s not that much different.” While it is unclear if the babies themselves ended up with a mosaic patchwork of cells, Dr. Musunuru said the data shows that Lulu’s placenta was mosaic, which is not a good sign … Dr. He has not submitted his data, nor has he identified the children or parents, other than to provide first names for the twin girls, Lulu and Nana; these may be pseudonyms. We won’t know for many years if Crispr affected genes other than CCR₅. Nor can we gauge the health of the babies now or in the future. And, of course, we do not know if other scientists will be emboldened to try their own experiments editing the genes of human embryos.

Das Business soll weiter gehen, Nature heute

So, how can the gene-editing community set up a better system? A starting point would be a global registry (or national registries) set up by funders or governments to record preclinical research that involves gene editing in human embryos.

He brauchte Security letzte Woche in Hongkong, so Science

For his talk at last week’s summit, He Jiankui was accompanied by security guards because of threats…
On the eve of the International Summit on Human Genome Editing in Hong Kong, China, last week, He, a researcher at nearby Southern University of Science and Technology in Shenzhen, China, had dinner at the city’s Le Méridien Cyberport with a few of the meeting’s organizers. The news of He’s claim had just broken, and shock waves were starting to reverberate. But the reports were still so fresh that the diners sat in the restaurant without being disturbed. “He arrived almost defiant,” says Jennifer Doudna … After more than an hour of questioning, He had had enough. “He just seemed surprised that people were reacting negatively about this,” Doudna says. “By the end of the dinner he was pretty upset and left quite abruptly.” … I got the strong impression that he saw Robert Edwards as a kind of hero, a paradigm breaker, a disrupter, and that he wanted to model himself after that … What’s more, He has not yet tested whether HIV can infect cells taken from the girls.”

China distanziert sich massiv von He (Bloomberg)

Less expected was the reaction of the Chinese government. On Nov. 29, Xu Nanping, vice minister of science and technology, told state TV that authorities had halted work at He’s lab and planned “a comprehensive and objective investigation of the facts of the incident.” Vice Minister of Industry and Information Technology Huai Jinpeng said the government intended to take a “zero-tolerance attitude in dealing with dishonorable behavior” in research and would bar He from a national science award for which he was a candidate.
Those signs that China may restrict genetic research more than previously thought mark a sharp contrast with the country’s approach to artificial intelligence…
An immediate response is needed, Doudna stresses. “I’d love to see the national science academies from several countries within a month come up with a set of draft guidelines that would be somehow affiliated with a RAC-like body,” she says. Daley agrees. “We have to aspire to some kind of a universal agreement amongst scientists and clinicians about what’s permissible,” he says. “Those who violate those international norms are held out in stark relief.”

Freitag 7.12. 2018

Auch die Politik meldet sich nun in Deutschland zu Wort.

Die Kandidatin für den CDU Parteivorsitz

Offensichtlich haben die Eltern auch chinesisches Recht gebrochen (“sperm washing” ist nur in Thailand legal). Sind die Zwillingsmädchen vielleicht auch in Gefahr? In Afrika gibt es eine gnadenlose Hetzjagd auf Albino Kinder.

Einen wichtigen Artikel habe ich übersehen – die NYT mit dem eigentlich ersten, auch schief gegangenen Versuch des Gene Editing.

In their 2001 report on this discovery, they called it “the first case of human germ-line genetic modification resulting in normal healthy children.” The germ line is a lineage of cells that gives rise to a new person. … The F.D.A. was not pleased. It sent the clinics letters demanding that they apply to test the method as if it was a new experimental drug. … So researchers went underground…. In 2016, an American fertility doctor named John Zhang announced that he had gone to Mexico to quietly carry out the procedure on a woman from Jordan with a neurological disease called Leigh Syndrome.

Sieht so aus als hätte die Honkong Konferenz die Slides nicht wie von allen Teilnehmern publiziert. 

Es gibt sie aber auf de Google Drive von Anirban Maitra. Die funktionelle Aufklärung der Mutationen bei Lulu und Nana in der Maus wird schwierig sein, da es das CCR5 hier nicht gibt. Allerdings gibt es eine “humanisierte” Maus aus der HIV Forschung.

Die ZEIT hat eine sehr gelungene Stellungnahme von Thomas Assheuer, das Hauptargument ist bei  Habermas entlehnt “Wie wir mit menschlichem Leben vor der Geburt umgehen, berührt unser Selbstverständnis als Gattungswesen.” (“Die Zukunft der menschlichen Natur”). In seiner Formulierung

Der Schock besteht darin, dass ein Forscher zum ersten Mal in der Geschichte etwas Ungeheures getan hat: Er hat in den pränatalen Anfang eines Menschenlebens eingegriffen und ihn neu programmiert. He Jiankui hat die Grenze zwischen Gewachsenem und Gemachtem überschritten, die Grenze zwischen dem genetischen Zufall der Natur und einem vom Menschen hergestellten Gegenstand. Auch wenn es über Menschenbilder immer uferlos Streit gab, so war doch eines unstrittig: Der Mensch ist keine Sache; die Würde der Person und die Unverfügbarkeit ihrer innersten Natur bilden eine unauflösliche Einheit. Genau das ist nun Geschichte.

Das Beste was es zur Ethik auf Deutsch zu lesen gibt, ist das Wortprotokoll des Ethikrates “Zugriff auf das menschliche Erbgut.
Neue Möglichkeiten und ihre ethische Beurteilung
“. 

CRISPR-Sonden und Cas9-Enzyme, diese Wesen zwischen Leben und Nicht-Leben, können in dem nur durch hochtechnische Apparatur erschließbaren, unendlich kleinen Miniaturwunderland von Zellen, DNA, RNA, Bakterien, Viren und Enzymen, DNA-Abschnitte in bisher unbekannt präziser Art ziemlich genau an eine Stelle bringen, einfügen, ausschalten oder verändern, wie es bisher für die Wissenschaftler ungeahnt war.

Bleibt noch ein SZ Artikel “Zweifel an Crispr-Babies“. An der Existenz bestehen wohl weniger Zweifel im Augenblick, mehr an den dubiosen Begleitumständen.

Wie das Wissenschaftsportal Statberichtet, erfuhr Mark DeWitt von der University of California, Berkeley, im September 2017 von He, dass eine klinische Studie zur genetischen Veränderung von Menschen unmittelbar bevorstünde. Ein Ethikkomitee habe zugestimmt, die Paare für das Experiment würden bereits rekrutiert. Warum DeWitt damals nicht Alarm schlug? Hes Mitteilung sei vertraulich gewesen, erklärt der Forscher jetzt. 

Samstag 8.12.2018

Jennifer Doudnas Alptraum

I had a dream recently, and in my dream”—she mentioned the name of a leading scientific researcher—“had come to see me and said, ‘I have somebody very powerful with me who I want you to meet, and I want you to explain to him how this technology functions.’ So I said, Sure, who is it? It was Adolf Hitler. I was really horrified, but I went into a room and there was Hitler. He had a pig face and I could only see him from behind and he was taking notes and he said, ‘I want to understand the uses and implications of this amazing technology.’ I woke up in a cold sweat. And that dream has haunted me from that day. Because suppose somebody like Hitler had access to this—we can only imagine the kind of horrible uses he could put it to.

Ein interview von ihr steht auf Twitter. He Jankui meldet sich auch wieder zu Wort mit einer Email an The Crimson

“I will publish my paper and this question will be answered in my paper” … He sent his email to The Crimson from what appeared to be his official Southern University of Science and Technology email address. He signed the message “JK” — fitting with previous media reports that he sometimes goes by his initials.

Ein wenig sinnvoller Zeitschriftentitel des New Scientist

da wäre es besser das nicht lesen zu müssen wie auch die LA Times Artikel.

Aus der Schweiz SRF “Hat er sie behandelt oder krank gemacht?”

Entwicklungsbiologin Maria Jasin … hält das Experiment für deutlich verfrüht: «Ich glaube, dass dieses Experiment nicht genügend überdacht wurde. Und ich sage bewusst, dass es ein Experiment war, denn eine therapeutische Behandlung ist es nicht.» … Molekularbiologe Dieter Egli, der an der Columbia Universität in New York forscht: «Die Regierungen müssen Entscheidungen treffen. Es ist sehr wichtig, dass man damit jetzt beginnt und es nicht weiter hinausschiebt.» Ansonsten geschehe genau, was jetzt in China passiert ist. «Es gibt Leute, die denken: Ich habe es begriffen und kenne Vorteil und Risiko. Jetzt gehe ich mal voran.»

 

Sonntag 9.12.2018

Twitter Screenshot

Die Nobelpreisträgerin Christiane Nüsslein-Volhard

Ein schlechter Versuch: Aus der Geburt der chinesischen Zwillinge muss die Wissenschaft Konsequenzen ziehen. Sie sollte begreifen, dass Genveränderungen immer untragbare Risiken mit sich bringen. Ein Gastbeitrag … Die Ausprägung (der Phänotyp) einer Genveränderung hängt ganz entscheidend vom gesamten Genom des Individuums ab, was man daran sieht, dass sich bei monogenen Erbkrankheiten des Menschen identische Mutationen mit sehr unterschiedlichen Krankheitsbildern ausprägen können.

Das st eigentlich ein Argument gegen jegliches Gene-Editing beim Menschen. Zudem findet sie

Vollkommen ins Reich der Utopie gehören Ansinnen, die Züchtung der Menschheit selbst in die Hand zu nehmen und Menschen durch Genom-Editierung besser, größer, klüger oder schöner zu machen. Das geht doch bei anderen Tieren und bei Pflanzen, warum nicht beim Menschen? Ich habe bereits darauf hingewiesen, dass gewünschte Genveränderungen mit großen Zahlen nicht gelungener Versuche einhergehen. Bei genetischen Experimenten mit Mäusen, Fischen, Rindern, Reis oder Rüben wird in hohem Maße Auslese betrieben. Durch Genom-Editierung lassen sich damit jetzt besonders leistungsfähige Nutztiere und Pflanzensorten erzeugen. Hier werden aus einer großen Zahl diejenigen Tiere oder Pflanzen, die die gewünschten Eigenschaften tragen, zur Fortpflanzung ausgewählt – beim Menschen undenkbar. 

Mit entsprechender Zeitverzögerung kommen nun die ersten medizinischen Journals. Der britische Lancet (Richard Horton?) schreibt, dass sich die Welt über Nacht geändert hat.

This was also not a situation of unmet medical need, since there are well-established and effective ways to prevent transmission of HIV or to treat it. Moreover, the role of CCR5 in the immune system is not fully understood, the girls may be more susceptible to other infections. It has become clear that this is really is no more than a human experiment, a proof of concept unlikely to confer any real benefit to the recipients but with unknown and potentially incredibly serious risks … Many experts had suggested that this development was imminent. Were we guilty of looking away and allowing this to happen? … Wilkinson asserts that these researchers have undermined the contract that scientists have with society; that contract allows research in situations where the risk to the patient is clearly calculated and the implications to the community at large have been appropriately considered. … Scientific culture has long been to accredit individuals with steps forward instead of recognising group achievement or incremental progress. This has created an ethos of celebrity in academia, which has sometimes rewarded maverick behaviour.