Der chinesische Menschenversuch

Der geplante Tabubruch  – eine kommentierte Presse- und Literaturschau.

Montag 26.11.2018

Wir haben es lange gefürchtet, es wird ein verrückter Einzeltäter sein, der als erster einen genmanipulierten Menschen produzieren wird. Nature berichtet heute mittag über eine Serie von Youtube Videos, die bereits gestern am 25.11.18 hochgeladen wurden.

He Jiankui, a genome-editing researcher from the Southern University of Science and Technology of China in Shenzhen, says that he implanted into a woman an embryo that had been edited to disable the genetic pathway that allows a cell to be infected with HIV … The scientist’s claims have not been verified through independent genome testing or published in a peer-reviewed journal. But, if true, the birth would represent a significant — and controversial — leap in the use of genome-editing. So far these tools have only be used in embryos for research, often to investigate the benefit of using them to eliminate disease-causing mutations from the human germline. But reports of off-target effects in some studies have raised significant safety concerns.

Die Literaturliste auf der Website von Jiankui He ist bescheiden, die schlecht synchronisierten Videos eines radebrechenden kleinen Mannes vor einer Laborkulisse triefen von Sendungsbewusstsein. Ist das Ganze nur ein Fake?

Twitter Screenshot

Ich frage mich natürlich, wieviele Embryos er wohl im Lauf der IVF Zeugung zerstört hat (20.000 laut Video), wieviele off-target sites er bei den Kindern produziert hat und was wohl ein zerstörter CCR5 Rezeptor bedeutet? Immerhin gibt es Erfahrung mit der CCR5 Deletion Δ32 eines Berliner Patienten. Sie stellt bei der viralen Enzephalitis und West Nile einen Nachteil dar. 

Ganz abgesehen davon haben IVF Kinder generell  Nachteile, von Geburtsdefekten angefangen, Methylierungsdefekten, Grösse und Gewichtsabweichungen bis hin zur Hypertonie.

Dienstag 27.11.2018

So verurteilen deutsche Ethiker unisono den Versuch als Grenzüberschreitung. Christiane Woopen im Tagesanzeiger.

Die chinesischen Forscher haben Menschenrechte verletzt und der Vertrauenswürdigkeit der Wissenschaft schweren Schaden zugefügt. Das sollte die internationale Gemeinschaft nicht dulden.

Der Vorsitzende des Deutschen Ethikrats, Peter Dabrock, in der FAZ

Sollte es sich bewahrheiten, dass ein mithilfe von Crispr genmanipuliertes Baby erzeugt worden ist, wäre dies für die
Wissenschaft ein Super-Gau. Dass ausgerechnet am Tag vor dem weltweiten Wissenschaftsgipfel in Hongkong, der über den verantwortlichen Umgang mit genome editing beim Menschen berät, ein solches Experiment bekannt wird, kann ja fast nur als Affront gegenüber dem Ansinnen verantwortlicher Wissenschaft gewertet werden.

Und die Welt fasst die erste chinesische Reaktion zusammen

Nicht nur international reagieren Forscher entsetzt, auch in China scheint der Versuch höchst umstritten: 122 chinesische Wissenschaftler haben in einem Protestbrief mit scharfer Kritik auf die Ankündigung ihres Kollegen He Jiankui reagiert. „Direkte Versuche am Menschen können nur als verrückt beschrieben werden“, heißt es darin. Es sei zwar möglich, dass die Kinder, die diesmal geboren wurden, für einen bestimmten Zeitraum gesund sind. „Aber die potenziellen Risiken und Schäden für die gesamte Menschheit, die durch einen ungerechtfertigten Einsatz des Verfahrens in der Zukunft entstehen können, sind unermesslich.“

Technology Review “Die CRISPR-Babys sind da”

Der Versuch, Kinder vor HIV zu schützen, fällt in eine ethische Grauzone zwischen Behandlung und Verbesserung. Das Verfahren heilt keine Krankheit oder Störung im Embryo, sondern will einen Gesundheitsvorteil schaffen, so wie ein Impfstoff vor Windpocken schützt […] In der chinesischen Gesellschaft ist der Gedanke stark, dass ein großen Vorteil für die Gemeinschaft schwerer wiegt als die Ethik des Individuums.

Technology Review liegt da etwas daneben, das ist keine ethische Grauzone, Enhancement ist keine Behandlung, sondern Eugenik.

Die Forderung nach einer Gentherapie Überwachungsbehörde (analog zur Internationalen Atomenergie-Organisation) ist berechtigt, aber naiv. Für die Urananreicherung braucht man Anlagen mit große Gaszentrifugen, das geht nicht im Hinterhof.  Zum Genome Editing braucht man ausser einem Ultraschallgerät, Brutschrank und Mikroskop für die IVF/PID und ein paar molekularbiologische Kits noch eine Firma, die einem das Genom sequenziert (Die GRÜNEN wollten in dem ersten Entwurf für das deutschen Gendiagnostikgesetz auch PCR Reagenzien unter Überwachung stellen, worüber aber heute niemand mehr reden will). Ich finde hier ist die Legislative gefordert und zwar weltweit.

Verge

If someone wants to create gene-edited babies, who would stop them? The legal framework around gene-editing babies is murky at best.

Interessant sind die unzähligen Kommentare unter den Artikeln, die in einer Stunde akkumulieren, beispielsweise

Das mit Begeisterung aufgenommene, erstes geklonte Schaf ,Dolly‘ musste nach 6 Jahren eingeschläfert werden. Über die Ursachen wird bis heute nur spekuliert. Die beiden Chinesinnen würden in dieser Relation nach 25 Jahren nicht mehr lebensfähig. … Das ganze Risiko ist in dieser Situation einfach unkalkulierbar. Das wiederum kümmert aber die Wissenschaft nur selten. Kurz vor dem ersten Atomtest im Alamogordo 1945, wurde der führende Physiker E. Teller gefragt: gäbe es irgendwelche Risiken bei der unvorstellbaren Konzentration an Energie nach der Zündung? Ja, doch … sagte der zukünftige Vater der Wasserstoffbombe: wenn wir Pech haben, können wir die Atmosphäre anzünden und in paar Minuten gibt es keinen Sauerstoff mehr auf Erden. Es war nicht sehr plausibel, aber unmöglich war das nicht. Nicht mal annähernde Experimente wurden vorher auf diesem Gebiet durchgeführt. Sie haben [sie] trotzdem gezündet.

Mittwoch 28. 11.2018

Einen Tag später ist das Medieninteresse ungebrochen. So gibt es ein NDTV Hongkong Conference Update

Summit chair David Baltimore, a Nobel laureate, said there had been “a failure of self-regulation by the scientific community because of a lack of transparency.” He’s claim would “be considered irresponsible”, Baltimore said.

The Nation

Qiu Renzong, formerly the vice president of the Chinese Ministry of Health’s ethics committee, told reporters at the gene editing conference that lax regulations in China mean that scientists who break the rules often face no punishment, and think of the ministry as being “without teeth”.

The Atlantic

The announcement was shocking in many ways: He made it via YouTube video. He doesn’t yet have a scientific paper to back up his claims. He’s a relative outsider with little published gene-editing experience. His own university now claims it was kept in the dark about his incredibly controversial research. If you were trying to concoct a scenario that inflamed all the worst fears about Chinese science, could you do better than this?

Ich verstehe dabei den Aufschrei nicht so recht. Gab es bei den ersten genmodifizierten Affen in China 2014 ( Luo et al.) überhaupt eine Reaktion?

Fortune

Bioethicist Alta Charo of the University of Wisconsin raised an entirely different point. “The children were already at virtually no risk of contracting HIV because it was the father and not the mother who was infected,” she said at the conference.

CNBC

“This is criminally reckless and I unequivocally condemn the experiment,” said Hank Greely, director of the center for law and the biosciences at Stanford University … The near-term consequence of this kind of research could be “sick babies, disabled babies, dead babies,” said Greely. Some high-profile critics, including Harvard University’s well-known geneticist George Church, shared concerns with the AP about the method that the researchers in China used to edit the embryos, as it appears that the HIV infection can still occur if only certain cells were altered.

Tagesspiegel

Staats- und Parteichef Xi Jinping machte es zu einem der Ziele des Landes, auch im Bereich Biotechnologie weltweit führend zu werden. Im 13ten Fünfjahresplan (2016- 2020) wurde Genomforschung als ein Bereich identifiziert, der sich für Direktinvestitionen lohne. Seitdem fließen die Gelder in die Genforschung. Erst im Dezember 2017 wurde das „100 000-Genome-Projekt“ ins Leben gerufen, das das Erbgut genauso vieler Menschen sequenzieren soll. Dafür gibt Chinas Ministerium für Wissenschaft und Technologie über elf Milliarden Euro aus.

Wired Artikel

We said “don’t freak out,” when scientists first used Crispr to edit DNA in non-viable human embryos. When they tried it in embryos that could theoretically produce babies, we said “don’t panic.” Many years and years of boring bench science remain before anyone could even think about putting it near a woman’s uterus. Well, we might have been wrong. Permission to push the panic button granted.

Langsam wird damit auch der Ablauf seit dem letzten Wochenende klar, wenn man dem Wired Artikel glaubt. Danach fand zuerst MIT Technology Review am 25.11. einen Eintrag in dem chinesischen Register, dass ein solcher Versuch läuft. Eingetragen wurde am am 6.11.18, also mehr als 1 Jahr nach dem Beginn der Versuche am 7.3.2017, dem Tag der eingetragenen Genehmigung durch die Ethik Kommission. Das Dokument wurde aber laut Metadaten aber erst am 16.5.2017 erstellt.

PDF Metadaten Ethik

Wann der Registereintrag online ging, ist nicht klar, er wird aber offensichtlich immer wieder noch geändert, zuletzt am 26.11.18. Mit der Datierung des Excel Sheets (siehe unten), den vielen fehlgeschlagenen Versuchen und den weiteren 9 Monaten der Zwillingsschwangerschaft, hat He lange vor der Freistellung an der Universität im Februar 2018 an dem Trial gearbeitet.

Screenshot Registereintrag

Wohl auf den MIT Artikel hin, lädt He panikartig seine vorbereiteten Werbevideos hoch, da sein eigentlich geplanter Artikel zur Ethik nicht mehr vor der Hongkong Konferenz online gehen wird. MIT Technology Review am 27.11. hat  dazu weitere Hintergrundinformationen. He Jiankui beruft sich auf ein “US National Academies of Sciences, Engineering, and Medicine” Statement, das ähnlich wie der britische Nuffield Report Wissenschaft keine Vorschriften machen will.  Nach dem Registerdokument ist  “primary sponsor” die Southern University of Science in Shenzhen. Da das Trial aber erst so spät und mit falschen Daten eingetragen wurde, sind Zweifel auch an diesen Angaben berechtigt.

Überliefert aus Honkong ist das nervöse Auftreten von He.

He seemed shaky approaching the stage and nervous during the talk. “I think he was scared,” says Matthew Porteus, who researches gene editing at Stanford University in California and co-hosted a question-and-answer session with He after his presentation. Porteus attributed He’s nervous demeanor to either the legal pressures that He faces or to the prospect of addressing a critical audience of scientists and members of the media.

Kein Wunder, er muss ja auch ein völlig blödsinniges Vorgehen rechtfertigen.

At the summit, He revealed that one of the genetically modified twins will be resistant to HIV, because the gene edits removed both copies of her CCR5 gene. The other twin could still be susceptible to infection because the gene-editing process inadvertently left one copy of her CCR5 intact, he said. He’s decision to implant the second embryo drew strong criticism. “Why choose this embryo? It just doesn’t make sense scientifically,” said Seoul National University geneticist Jin-Soo Kim. During his talk, He said he had explained the situation to the parents and they decided they wanted to do it anyway.

Die erste Reaktion des Gene Summits in Hongkong fällt dann aber doch verblüffend nichtssagendend aus:

One such study, a 2017 report by the U.S. National Academies of Sciences, Engineering, and Medicine, concluded that clinical trials might be permitted after peer-reviewed preclinical research further clarifies the potential risks and benefits, only for compelling medical reasons in the absence of reasonable alternatives, and with maximum transparency and strict oversight. The report noted that such research should be approached with caution and with broad public input. It specified a regulatory framework that included ten recommended criteria and structures. … Whether the clinical protocols that resulted in the births in China conformed with the guidance in these studies remains to be determined.

was entsprechende Reaktionen provoziert

Twitter Screenshot

Damit gehe ich nun nicht mehr von einem Einzeltäter aus – seine Arbeitsgruppe an der Universität bestehend aus Jinzhou Qin, Shuo Song und Xiaoqing Zhou muss schliesslich auch an irgendetwas gearbeitet haben. Stellenausschreibungen auf seiner nicht mehr online verfügbaren Webseite beschreiben das Forschungsprogramm:

Multiple postdoctoral positions are available in Dr. Jiankui He’s laboratory in South University of Science and Technology of China (SUSTC). Dr. He is building up the Genome Center at SUSTC, with the most advanced high throughput sequencers such as Illumina Hiseq, Miseq, Ion Torrent and Roche 454. We are initiating an international collaborative study “The International Human Immunome Project”. The International Human Immunome Project aims to sequence the immune repertoire of 10,000 patients and identify disease-specific T or B cell receptor sequences for 100 diseases such as cancers, autoimmune diseases, infectious diseases and other immune related diseases.
Position A:candidates should have research experience in immunology, preferably, B cells and T cells.
Position B: candidates should have research experience in cancer biology, preferably, tumor immunology.
Position C: candidates should have extensive research experience in high throughput sequencing.
The salary for these positions is 150,000-200,000 RMB per year. Contract is renewable. Candidates has previous postdoc research experience are able to consider for research scientist position.

Von der Crispr Szene vielleicht aktuell sicher nicht gewollt, in China aber eher akzeptabel, kann sich He Jiankui in der Tat auf diverse einschlägige Dokumente berufen. Und er war nicht ganz der Aussenseiter wie er jetzt gerade hingestellt wird und hat 2017 in Cold Spring Harbor gesprochen, so STAT

He’s career trajectory highlights a few salient facts: His scientific background is wide-ranging, but lacking in deep expertise in CRISPR and embryology. Public records indicate that he is just 34 years old, an age when many top researchers are just opening up their first labs.
He, who appears to have been born and raised in China, earned his undergraduate degree in physics from the University of Science and Technology of China in 2006. He then moved to Texas to earn his Ph.D., in biophysics, at Rice University in Houston; his adviser there, the bioengineering professor Michael Deem, would later collaborate with him on the CRISPR’d embryos project.
After graduating in 2010, He spent about a year doing his postdoc in the lab of Stanford bioengineer Stephen Quake. It was there that He learned about single-molecule sequencing ― a then-revolutionary method of sequencing single DNA molecules without first having to copy them using polymerase chain reaction, according to a 2015 story in the publication Bio-IT World.
He moved back to China around 2012. It’s not clear why he decided to return home, but a few factors may have come into play. He wanted to spin off companies from his academic research back in China, according to Bio-IT World. And financial incentives may have contributed to his decision: He moved back to China as part of the Thousand Talents program, an initiative in which the Chinese government has offered incentives to try to bring back its best and brightest scientists and entrepreneurs who did their training in the U.S.

Ethik wird zur Akzeptanzbeschaffung degradiert, zumal nun auch heute sein länger geplanter Artikel in einem predatory journal online ging (Liebert, Volume 1, Number 6, “authors are asked to fill out a short open access order form. You can pay by credit card”). Hier wiederholt He Jiankui (zusammen mit  Ryan Ferrell,  Chen Yuanlin, Qin Jinzhou und Chen Yangran) seine selbstkonstruierten Regeln, wohl ahnend, dass die Akzeptanzgering sein wird.

Interessenskonflikte: keine. Dabei kam heute heraus, dass He seit 2015 eine eigene Firma betreibt: directgenomics.com (zusammen Qin Yan, Liangjin Ye, Zefei Jiang, Zhiliang Zhou, Luyang Zhao). Über weitere Firmenbeteiligungen wird spekuliert. Die Sequenziertechnik ist schwer einzuschätzen, ein Einzelmolekülverfahren, rebranded oder Eigenentwicklung? Ich hoffe, er hat die Embryos nicht damit sequenziert, Details auf nature biotechnology review.

Sequence providers, potential customers, are in wait-and-watch mode. Ruiqiang Li, CEO of the Beijing-based genomics services provider Novogene, which has one of the few Illumina HiSeq X Ten whole genome sequencing platforms in China, says that by avoiding PCR amplification, single-molecule sequencing avoids bias, but a high error rate has proved a challenge. “It’s a very important step forward. But we see that Helicos failed, and PacBio and Oxford Nanopore have very high sequencing error rate,” says Li.

Ich vermute mal , er hat bei B.G.I. Shenzhen sequenzieren lassen.

Bei den Antragsunterlagen habe ich zudem ein Excel Sheet in dem Register gefunden, das lauf Metadaten vom 5.6.2015 stammt, also fast 2 Jahre älter als der bisher angenommene Versuchsbeginn am 7.3.2017 (2012 kam er nach China zurück).

Excel Metadaten

Tabelle 1 fehlt in dem Excel Sheet. In Tabelle 2 findet sich für beide Embryos (?) die Zusammenfassung einer genomweiten (?) Auswertung. Fragezeichen deshalb, weil es  extrem wenig Einträge aufweist.

Beide Kinder haben wohl genetisch das Risiko eines Glutaryl-CoA-Dehydrogenase-Mangel, eine autosomal-rezessiv vererbte neurometabolische Störung mit enzephalopathischen Krisen durch Striatum-Läsionen und schwerer dystonisch-dyskinetischer Bewegungsstörung. Neugeborene sind meist symptomfrei, haben aber in 75% der Fälle eine Makrozephalie. Wissen das die Eltern von Lulu und Nana oder weiss das nur das Internet? Ich glaube nicht, dass die Variante rs8012 de novo aufgetreten ist. In zwei unabhängigen Zygoten dieselbe Mutation? rs8012 ist signifikant mit Glutaroylcarnitin Spiegel assoziert (Shin 2014) führt zu dem Aminoaustausch GLN417ARG, den ich bei OMIM nicht finde (dort gibt es VAL400MET, ARG402TRP, THR416ILE, ALA421VAL). Nach einer ägyptischen Arbeit liegt der SNP rs8012  im 3’UTR und ist wohl eher geringer phänotypisch wirksam, als die anderen GCDH Mutationen.

Es sieht nach dem Excel Sheet so aus, als hätte He Jiankui der schwangeren Mutter in der 12., 19. und  24. Woche Blut abgenommen, um cfDNA (zellfreie fetale DNA) zu sequenzieren. Das war dann wohl die ganze medizinische Kontrolle während der Schwangerschaft? Keine Amniozentese?

Die erste Sequenz “CAGAATTTATACCCACACTAGGG”auf chr1 ist off target, mir ist nicht klar, was sie an der Stelle soll. Die zweite “CAGAATTGATACTGACTGTATGG” mit einem 6 Basen Offset auf chr3 ist im CCR5 Locus und taucht ansonsten nur noch in einem chinesischen Paper auf (“Inhibition of HIV-1 infection of primary CD4+ T cells by gene editing of CCR5 using adenovirus-delivered CRISPR/Cas9” sowie in einem PNAS Artikel (“Human genetic variation alters CRISPR-Cas9 on- and off-targeting specificity at therapeutically implicated loci”). Das waren also seine “Vorversuche” – einfach etwas aus der Literatur abgeschrieben.

Ärzteblatt

Eine unabhängige Bestätigung für Hes Behauptung gab es zunächst nicht. Der Wissenschaftler betonte aber, er habe Forschungsunterlagen bei einer Fachzeitschrift eingereicht. Gleichzeitig gab er an, seine Forschung sei unerwartet an die Öffent­lichkeit gedrungen. Dies ist umso erstaunlicher, als He die Nachricht in einer Ansprache über Youtube selbst verbreitet hatte – kurz vor Beginn des Kongresses.
Dort waren die Versuche das dominierende Thema. „He hat in einer großen Halle der Universität gesprochen, und die war bis auf den letzten Platz voll“, sagte der Biochemiker Ernst-Ludwig Winnacker, der an dem Kongress teilnahm. „Er machte einen gut vorbereiteten Eindruck und trat sehr selbstbewusst auf.“ Bei dem Vortrag wiederholte He, er habe mehrere kinderlose Paare aus gesunder Mutter und HIV-infiziertem Vater dazu gebracht, bei den Versuchen mitzumachen. Am Ende habe eines der Paare Zwillinge bekommen. „Auf diesen speziellen Fall bin ich wirklich stolz“, sagte er.

Wired

It’s too soon to say whether He’s stunt will bring him fame or just infamy. He’s still scheduled to speak at the human genome editing summit on Wednesday and Thursday. And China’s central government in Beijing has yet to come down one way or another. Condemnation would make He a rogue and a scientific outcast. Anything else opens the door for a Crispr IVF cottage industry to emerge in China and potentially elsewhere.

Donnerstag 29.11.18

Transkript

AP

First, sperm was “washed” to separate it from semen, the fluid where HIV can lurk. A single sperm was placed into a single egg to create an embryo. Then the gene editing tool was added.
When the embryos were 3 to 5 days old, a few cells were removed and checked for editing. Couples could choose whether to use edited or unedited embryos for pregnancy attempts. In all, 16 of 22 embryos were edited, and 11 embryos were used in six implant attempts before the twin pregnancy was achieved, He said.
Tests suggest that one twin had both copies of the intended gene altered and the other twin had just one altered, with no evidence of harm to other genes, He said.

SZ

Chinesische Medien berichten, He habe für seine Versuche keine Genehmigung eingeholt. Die chinesische Regierung hat eine “unverzügliche Untersuchung” angeordnet. Der Vize-Minister für Wissenschaft und Technologie, Xu Nanping, bezeichnete das Experiment als illegal. Die Nationale Gesundheitskommission teilte am Dienstag in Peking mit, man prüfe, ob der Fall mit den Gesetzen zum verantwortlichen Umgang mit der Gesundheit der Menschen übereinstimme. He sagte in Hongkong, außerhalb seines Teams habe er sich nur mit vier Personen abgesprochen, darunter ein US-Forscher und ein Mitglied der Chinesischen Akademie der Wissenschaften.

Nature

Many scientists faulted He for a lack of transparency and the seemingly cavalier nature in which he embarked on such a landmark, and potentially risky, project.

NYT

China excels in most kinds of technology, but when it comes to gene editing and designer babies, it has an extra advantage: a population that has been conditioned to manipulating reproduction as a tool for progress. I’m referring, of course, to the three decades of family-planning rules known as the one-child policy.
Behind the science of what’s doable is the mind-set of what’s desirable. China’s unprecedented reproductive experiment, officially ended in 2015 although many restrictions continue, has created a people accustomed — in many cases, forcibly so — to controlling the number and gender of their offspring.

MIT Technology Review

These two children are the guinea pigs. They will go through their whole maturing process having not understood the risks ahead of time,” said Liu Ying of Peking University’s Institute of Molecular Medicine.

Science

Ethics aside, does the CRISPR baby experiment make scientific sense? … Is it possible that CRISPR led to mutations that didn’t cripple CCR5? Yes. Mutated genes sometimes still produce functional proteins.

futurezone

Die chinesische Regierung hat dem Forscher He Jiankui und seinen Mitarbeitern weitere Forschungsaktivitäten untersagt … Die von He berichtete Erzeugung genmanipulierter Babys sei „äußerst abscheulicher Natur“ und verletze chinesische Gesetze und die wissenschaftliche Ethik, sagte der stellvertretende Wissenschaftsminister Xu Nanping der staatlichen Nachrichtenagentur Xinhua am Donnerstag. Zuvor hatten sich schon die Nationale Gesundheitskommission des Landes und die Chinesische Gesellschaft für Wissenschaft und Technologie (CAST) von He distanziert.

Stat

William Hurlbut first met He (whom he calls JK) in January 2017, at a workshop that Hurlbut and CRISPR pioneer Jennifer Doudna of the University of California, Berkeley, held at Berkeley to discuss ways to educate and engage the public on issues raised by human genome editing. The Chinese scientist did not participate actively in group discussions (his English is somewhat halting). “I have no clear impression of what his views were on these crucial points,” said a leading American expert on science policy who asked not to be named because the workshop was private. He nevertheless left an impression of “great smoothness,” this scholar said, adding, “He and his more senior Chinese colleague clearly did not have deep misgivings about plugging ahead with gene editing, and I sensed no exposure to the sorts of ethical debates our guys are routinely involved in.”

Das spricht alles gegen einen Einzelgänger. He Jiankui räumt ein, vier Personen hätten Bescheid gewusst, da gehört vermutlich auch Michael W. Deem, sein Doktorvater dazu.

Freitag 30.11.18

CNN

“The simple fact that he was directly involved in trying to get consent from the patients is a huge problem,” said Robin Lovell-Badge, head of the Laboratory of Stem Cell Biology and Developmental Genetics at the Francis Crick Institute, who moderated the discussion with He. “You should never do that. You should have an independent third party who can properly explain the risks and the benefits.”

Wayback hat zum Glück eine Kopie der Webseite von He Jiankui gezogen, die mittlerweile nicht mehr online ist.

Ein Wikipedia Eintrag erscheint zu Lulu und Nana.

Das NIH will nun doch Keimbahnänderungen regulieren.

While Collins said in a statement issued Wednesday that the revelation of CRISPR babies highlighted the need for a “binding international consensus” on germline gene editing, he acknowledged there is little consensus as to how governments should translate such scientific opinions into law. It is “not entirely obvious,” Collins said, that the United Nations is the international body best equipped to police gene-editing research either.

Das Organisationskommitee der Konferenz in Hongkong schliesst sich den weltweiten Protesten an.

Report of Clinical Use of Germline Editing
At this summit we heard an unexpected and deeply disturbing claim that human embryos had been edited and implanted, resulting in a pregnancy and the birth of twins. We recommend an independent assessment to verify this claim and to ascertain whether the claimed DNA modifications have occurred. Even if the modifications are verified, the procedure was irresponsible and failed to conform with international norms. Its flaws include an inadequate medical indication, a poorly designed study protocol, a failure to meet ethical standards for protecting the welfare of research subjects, and a lack of transparency in the development, review, and conduct of the clinical procedures.
An Ongoing International Forum
The organizing committee calls for an ongoing international forum to foster broad public dialogue, develop strategies for increasing equitable access to meet the needs of underserved populations, speed the development of regulatory science, provide a clearinghouse for information about governance options, contribute to the development of common regulatory standards, and enhance coordination of research and clinical applications through an international registry of planned and ongoing experiments.

Guardian

The Southern University of Science and Technology in Shenzhen, where He is an associate professor, has said it had no knowledge of his research.
The scientist has said his project was approved by an ethics committee at Harmonicare Shenzhen women and children’s hospital, which has also denied any involvement.

Aktienkurse diese Woche

Bloomberg Crispr Aktien steigen leicht. Im Internet gibt es immer mehr “crispr baby comics”.

Ich denke, man sollte He weder heroisieren (“auch Jenner musste Risiken bei der Pockenimpfung eingehen”) noch dämonisieren (“200 Jahre Frankenstein”, “21 Jahre Gattaca”) sondern primär seine dreiste Vorgehensweise konstatieren, sich überall an Methoden zu bedienen, keine Vorversuche zu machen und zu publizieren, und ohne Skrupel Menschenversuche ohne deren Einverständnis zu machen. Die Aussagen seines Vaters

He was always first in primary school, middle school, university and after that. He was never second. Always first,” his father told Beijing News.

Nature mit 6 Fragen

1. Is He Jiankui in trouble?
2. Are He’s claims accurate?
3. How exactly did CRISPR edit the twins’ genomes?
4. When will there be another gene-edited human?
5. Will He’s revelations hamper ethical efforts to do germline editing?
6. How will scientists ensure better oversight of germline editing in future?

Samstag, 1.12.2018

Bisher findet nur ein einziger Genetiker He’s Versuche richtig: George Church, wer hat es auch anders erwartet.

I’d just as well not hang myself out to dry with someone I barely know, but I feel an obligation to be balanced about it. I’m sitting in the middle and everyone else is so extreme that it makes me look like his buddy. He’s just an acquaintance. But it seems like a bullying situation to me. The most serious thing I’ve heard is that he didn’t do the paperwork right.

Es geht hier aber eigentlich nicht um irgendwelches Papier, sondern um Menschen. Es scheint, wir müssen in der Genetik viele profilierungssüchtige Mitmenschen aushalten wie  Craig Venter  oder James Watson, selbst Verbrecher wie William French Anderson, Hwang Woo-suk oder Severini Antinori.

Vox

That’s because there are real limits to what CRISPR can do, at least right now. Scientists have recently learned that the approach to gene editing can inadvertently wipe out and rearrange large swaths of DNA in ways that may imperil human health. That follows recent studies showing that CRISPR-edited cells can inadvertently trigger cancer.

Keine Reaktion bis jetzt von Louise Brown

Screenshot Website

NYPost

…if we are separated into the enhanced and unenhanced, respect for the dignity of every human life will be diminished. So will personal responsibility. If we don’t make it in life because we are unenhanced, it’s not our fault. And if we do because we are enhanced, we don’t get the credit. … Then there is the threat to women’s equality. If genetic engineering can offer the promise of eliminating disease, it will also allow parents to choose the sex of their child. That could lead to greater sex discrimination. … It will also lead to an explosion in the number of discarded children. For every child born via in vitro fertilization, there are multiple fetuses which are created but never used. Today, the Department of Health and Human Services reports, there are more than 600,000 cryogenically frozen embryos in the US. If genetic engineering through in vitro fertilization becomes common, that number will skyrocket, sparking a profound moral crisis.

Die FAZ hat nun auch den “Ethik”-Artikel zu dem unsäglichen “Trumpismus”

Eine Ethik-Lehrstunde für das Establishment, vom Tabubrecher höchstselbst. Kein Witz! Man glaubt es nicht. Kann es wirklich sein, dass Dr. He, jener Wissenschaftler, der am Montag nach allen Regeln der PR-Kunst und ohne jede Rücksicht auf Standesregeln die Geburt von genmanipulierten Zwillingen als gezielten Tabubruch inszeniert hat und seinerseits jeden Berufsethos hat vermissen lassen? Ist es also möglich, dass ebendieser Gen-Guerillero der weltweiten Wissenschaftltergemeinde ernsthaft eine Anleitung für ethisches Handeln in der Reproduktionsmedizin vorlegt?

Kommentar unter dem FAZ Artikel

Empörung vorne – stille Freude hinten
Es wundert mich nicht, dass genau so ein Eingriff jetzt gemacht wurde, sobald die technischen Voraussetzungen dafür geschaffen sind. Freiwillige Einschränkungen oder Unterlassungen aus moralischen, ethischen usw Gründen funktionieren in der Menschheit eben leider nicht.

Twitter Hashtags, ab sofort hat He auch einen Fake Account



leider am nächsten Tag auch schon wieder gelöscht.

##crisprbabies #scicomm #crispr #geneediting #HeJiankui #kingkongvogel #LucidQuest #followthepatient #genetherapy #apocalypse #baby #controversy #Harvard #University #science #sciencemm #editing #dna #biology #neuroscience #molecularbiology #cas9 #crisprcas9 #Bio ##dream #practice #Russia #Geneticsschool #genetics #artificialintelligence #virtualreality #augmentedreality #mixedreality #medicalscience #bigdata

He Jiankui (oder ein Mitarbeiter) registriert ein weiteres Trial . Da komme ich mir vor wie 9/11 wo niemand wusste, wieviel Flugzeuge denn nun entführt wurden.

Gene therapy is to replace or correct the defective genes of patients by genetic engineering technology, so as to achieve the goal of eradicating hereditary diseases. In 2017, the first gene therapy was approved in the United States, and the first human genome editing clinical trial started. In this study, we will use the most popular CRISPR/Cas9 gene editing technology and its derivative single base mutation technology to carry out exploratory experiments on the abandoned human embryo samples (mainly 3PN samples) from the assisted reproduction process. The donors of the human embryos are consent informed. At present, we have selected the CCR5 and PCSK9 genes as the research targets. Through this study, point mutations in diseases are accurately repaired to prevent the disease, or to regulate the expression of the pathogenic gene, so as to cure the related diseases. At the same time, the related samples will be sequenced in depth, and the related genes can be analyzed to reveal the mechanism of infertility to improve the pregnancy outcome of infertility.

Practical Ethics Blog

The basic principles of research ethics are:
Risk should be reasonable (See Savulescu & Hope, The Ethics of Research). This includes that risks are minimized and that there are proportionate benefits. There would have been less expected harm if embryos with lethal disorders were used. Any child produced would stand to derive a very significant benefit: having their life saved. Lulu and Nana derive no direct benefit: HIV can be prevented in numerous ways, including by protected sexual intercourse. Yet they were exposed to significant risk of off target mutations and cancer. The benefits to them are not proportionate to the risk.
Consent should be obtained. Clearly embryos cannot consent. Research on incompetent participants can be ethical if it is minimal risk or the benefits are proportional to the risks. This would only be the case if the embryo had a lethal disorder, and not when the embryo and future child only stands to be harmed with no direct benefit.

Sonntag 2.12.2018

Google Photos, nun endlich mit der Versuchsanordnung

Warum der Versuch, unethisch und wissenschaftlich dubios ist:

Twitter Screenshot

Damit verstehe ich ich die 1# OT Sequenz des Excel Sheets. In der Tat sehr weit off target mit geringem Konsensus, zum Glück aber cold spot.

Lalign target und off target

Nun auch noch mehr Sequenzdaten als in dem Excelsheet

Twitter Screenshot

Irgendetwas stimmt da nicht, das trifft nicht genau die delta 32 Mutation. Da das Register nicht mehr online ist, hier das Excel 65bc3ccdc7284a2fab1e1e6d12bb5d03.xlsx. Die Arbeit hat sich gerade schon Sean Ryder gemacht:

Schwierig zu sagen was die Mutation funktionell machen. Delta32 verliert jedenfalls über 137 Aminosäuren. Im 3D view sieht Delta32 massiv aus, nicht zuletzt durch den Frameshift. Lulu wird wohl nicht HIV geschützt sein, allenfalls Nana, wer weiss das schon? Genau wie Sean Ryder sagte

what really bothers me. The children are test subjects for protein variants that haven’t been vetted in animals

Vermutlich kommt die Grundidee JK’s von einem älteren Science Paper über somatische Gentherapie. 
Die Technik ist im übrigen sehr fehleranfällig, es gibt ein neues Paper auf biorxiv.org von dem ich 10 OTs erwarten würde, JK hat aber nur 1 gefunden.

We applied GOTI to both the CRISPR-Cas9 and base editing (BE3) systems by editing one blastomere of the two-cell mouse embryo and then compared whole genome sequences of progeny-cell populations at E14.5 stage. Sequence analysis of edited and non-edited cell progenies showed that undesired off-target single nucleotide variants (SNVs) are rare (average 10.5) in CRISPR-edited mouse embryos, with a frequency close to the spontaneous mutation rate. By contrast, BE3 editing induced over 20-fold higher SNVs (average 283), raising the concern of using base-editing approaches for biomedical application.

Dazu kannte er wohl auch nicht den zell-spezischen Bias jeder gRNA.

Each gRNA has an individual cell-line-dependent bias toward particular outcomes.

Damit kommt nun die Stunde der Kommentatoren. Die einen wollen, dass alles so weiter geht (ZEIT)

Diese Zäsur darf nicht das Ende von Crispr sein
Kamen genetisch veränderte Babys auf die Welt? Egal, ob die Nachricht von Versuchen an Menschen stimmt – sie bringt eine Gentechnik in Verruf, die Leben retten kann.

MIT Technology Review

Despite CRISPR baby controversy, Harvard University will begin gene-editing sperm
Even as a furious debate broke out in China over gene-edited babies, some scientists in the US are also hoping to improve tomorrow’s children.

Die TAZ mit einem Boyle Interview

Wovor haben wir am meisten Angst? Das Experiment in China ist bislang nicht mal bewiesen – und die Empörung riesig.
Wir sind Produkte der Natur. Wir leben auf einem mysteriösen Planeten und kennen die wesentlichen Antworten auf unsere Existenzfragen nicht: Warum? Was ist passiert? Wo kommt es her, was bedeutet es? Die gesamte Menschheitsgeschichte und Evolution wird durch etwas wie die Crispr-Technologie negiert. Menschliche Designerbabys: Damit beginnen wir eine neue evolutionäre Zeit

Die hier bisher geschilderte Version des Zeitablaufes scheint zu stimmen, siehe Quartz

He Jiankui didn’t wake up on Sunday expecting his world to change. He’d authored a paper that was to be published on Monday, and planned to speak about his work at the most important conference in his field of study on Wednesday. And he’d spoken with a reporter from the Associated Press (AP), so he was likely aware that sometime before his speaking engagement, the AP might publish a blockbuster report about his great scientific achievement. He knew international attention was coming for him, and he had a plan.
Then Antonio Regalado, biomedicine editor at MIT Technology Review, ruined it. On a recent trip to China, Regalado heard rumors that He’s lab at the Southern University of Science and Technology in Shenzhen was undertaking research on gene-editing human fetuses. A simple Google search using the terms “He Jiankui” and “CCR5” (the gene being edited) led him to clinical-trial registration documents that revealed He had recruited couples for a clinical trial to create the world’s first gene-edited baby. Regalado called He on Sunday morning (Nov. 25) to ask whether the trial had led to the birth of any gene-edited babies. But He declined to comment.

Vielleicht einmal zwischendurch: Ich hatte mit mehreren chinesischen Kollegen Kontakt, die alle entsetzt sind.
Hier kommt nun auch noch die übersetzte Version des Ethikantrages von www.chictr.org.cn/ Das Hospital, das in diesem Antrag genannt wird, sagt allerdings, die Unterschriften auf dem Original seien gefälscht.


Der letzte Satz hört sich schon nach Grössenwahn an

in order to stand out in the increasingly competitive applications of gene-editing techniques in the whole world. This will be revolutionary research that surpasses the 2010 Nobel Prize winning research in in-vitro fertilization, and it will bring hope to the treatment of countless major genetic diseases.

ist allerdings nicht ganz so harmloser Unsinn wie auf der (nicht mehr verfügbaren Website) dass JK durch Umweltnoxen induzierte Mutationen heilen will. Paul Knoepfler fragt

An underappreciated part of He-#CRISPR story is that there are effective CCR5 inhibitor drugs out there including Maraviroc which is listed in >150 clinical trials. If you can drug an allele/protein, why take risks of Indel-focused germline mutation?

Sean Ryder (von dem die exzellente Annotation stammt, die hundertfach retweetet wurde)

#CRISPRbabies The ClinVar database lists two frameshift mutations in CCR5, of these only Delta32 is annotated as protective. The 1000 genomes project identified 10 more, and three in frame deletions. Table and link to ALL variations here:

Für das RNA design hat er angeblich Synthego verwandt, das im Augenblick aber das Protospacer Adjacent Motif (PAM) etwas früher legt.  Die Idee des Synthego Designs ist dabei ein knockout/Genausfall, während He wohl die Delta32 Mutation imitieren wollte. Warum eigentlich nicht gleich den kompletten Genverlust anpeilen?

 

Montag 3.12.2018

Es haben nun doch viel mehr Bescheid gewusst, so AP heute

But three Stanford scientists — Hurlbut, Porteus and He’s former fellowship adviser, Stephen Quake — had extensive contact with him over the last few years. They and other scientists knew or strongly suspected that He intended to try to make genetically edited babies…
In a draft article about the gene-edited twin girls, which He planned to submit to journals, he thanked UC Berkeley biophysicist Mark DeWitt for “editing the manuscript.” …
Michael Deem, a bioengineering professor at Rice University and He’s doctoral degree adviser, said he had worked with He since the scientist returned to China around 2012, and that he sits on the advisory boards and holds “a small stake” in He’s two genetics companies in Shenzhen. Deem defended He’s actions, saying the research team did earlier experiments on animals.

Das chinesische Ethik Dokument aus dem Register weicht dabei von dem englischen Dokument auf der Webseite ab. Ausserdem gibt es Diskrepanzen zwischen der Versuchsbeschreibung im Register, der Webseite, dem Hongkong Vortrag, den Youtube Videos sowie den Aussagen Dritter. Es wird Wochen brauchen für die Kommissionen, die Fakten zu sortieren, vor allem falls He auch noch absichtlich falsche Darstellungen produziert hat.

Das Youtube Video “About Lulu and Nana” errreicht mittlerweile Rekordzahlen, im Augenblick über 276.000 Aufrufen  und über 2.000  Kommentare.

You just opened Pandora’s box on behalf of the entire human race.

West Nile Virus laut CDC Details

About 1 in 5 people who are infected develop a fever and other symptoms. About 1 out of 150 infected people develop a serious, sometimes fatal, illness.

Es gibt auch in China – Erkrankungsfälle laut Global Ecology and Epidemiology of West Nile Virus (Shenzhen liegt direkt bei Hongkong).

Eigentlich ist dieses Projekt wissenschaftlicher Hochverrat, das die Genetik auf Jahre hinaus in Verruf bringt.  Oslo wird 2019  den Nobelpreis nicht an Doudna & Charpentier vergeben können.

Es ist aber auch eine ethischer Katastrophe, wenn den Eltern nach dem archivierten (und mittlerweile nicht mehr verfügbaren Protokoll Second-informed-consent-English.pdf )

  • 50,000 Yuan für den Versuch angeboten werden plus 200 Yuan/Tag für die 28 Tage dauernde Untersuchungen nach der Geburt
  • ihnen Anonymität versprochen wird (die nicht zu halten sein wird)
  • die Gene von “Nordeuropäern” versprochen werden
  • wahrscheinlicher HIV Schutz
  • ohne Risiko von “off-targets”
  • das Risiko aller Fehlbildungen zu Lasten der Eltern geht
  • die Eltern nicht mit der Presse reden dürfen
  • alle Fotorechte He Jiankui gehören

E sieht immer mehr danach aus, dass er -gewollt oder nicht gewollt- eine finanzielle Notlage der HIV Paare ausgenutzt hat, die sich ansonsten “sperm washing” nicht leisten können. Wie aber sonst hätten sie Kinder bekommen sollen? So legt es jedenfalls das Sanlian Life Week Dokument  (weiter unten) nahe.

Zheng Xiao [pseudonym] had considered going to Thailand for sperm washing. But from what he found out online, it would cost hundreds of thousands of dollars, and the in-vitro fertilization process would cost hundreds of thousands more. He and his wife lived in a small county, worked ordinary jobs, and could not dream of affording it. So when he saw the news of He Jiankui recruiting for his study, Zheng Xiao felt as if a small sliver of light appeared before his eyes.

Und was die amerikanische Beteiligung angeht: Sie erinnert mich fatal an Scott Weiss und Xu Xiping  von der Harvard University der damals die  Anhui Studie nicht auswerten durfte, weil den Probanden falsche Tatsachen vorgespiegelt wurden ( Quelle ).

DLF

Jürgen Habermas hat Arendts Begriff vor einigen Jahren aufgegriffen, um zu begründen, worin die grundsätzliche Gefahr menschlicher Eingriffe in das Erbgut Neugeborener liege. Ein Mensch, der erkennen müsse, dass Teile seines Erbgutes nach den Präferenzen anderer programmiert wurden, müsse seine Natalität und damit seine Würde als eingeschränkt erleben. Er könne sich nicht mehr als voraussetzungslosen Neuanfang verstehen, und damit nicht mehr als Autor des eigenen Lebens.

Dienstag 4.12.2018

Die Rice Universität distanziert sich von Deem.

Mich erinnert der Fall von Michael Deem & He Jiankui sehr an Scott Weiss & Xu Xiping Washington Post 2000

Screenshot

Economist

It may even be that editing will one day be used on embryos to enhance genomes (to make people cleverer, say), rather than to cure disease. But that requires regulators, policymakers, scientists and civil society to think through deep ethical questions. … Such debate was always going to be needed. Now it is urgent.

Paul Knopfler fordert ein 3 Jahres Moratorium in STAT

I watched a livestream of parts of that meeting. I was surprised that He was scheduled to speak at it — twice. One other talk really shook me: Dr. George Daley, dean of Harvard Medical School and one of the summit organizers, made the case in favor of human germline editing in the not too distant future and vaguely characterized He’s effort as just a “misstep.” … But the organizers of the 2018 meeting diluted their statement’s impact by making the case for a path toward future human germline gene editing if strict criteria are met. This path, combined with the earlier words of Daley and other speakers at the meeting arguing in favor of moving toward such a goal, yield a mixed message. … Unlike the meeting organizers, I favor a low-risk, temporary, three-year moratorium on implantation of gene-edited human embryos to make genetically modified babies.

The Atlantic hat die beste Einschätzung von dem was bisher passiert ist

The alleged creation of the world’s first gene-edited infants was full of technical errors and ethical blunders. Here are the 15 most damning details.
1. He didn’t address an unmet medical need
2. The actual editing wasn’t executed well
3. It’s not clear what those new mutations will do
4. There were problems with informed consent
5. He operated under a cloak of secrecy…
6. … organized a slick PR campaign
7. A few people knew about He’s intentions but failed to stop him
8. He acted in contravention of global consensus
9. He acted in contravention of his own stated ethical views
10. He sought ethical advice and ignored it
11. There is no way to tell whether He’s work did any good
12. He has doubled down
13. Scientific academies have prevaricated
14. A leading geneticist came to He’s defense
15. This could easily happen again

Sanlian Life Week (cited here)

Although He Jiankui and his team told Zheng Xiao that their technology was “sufficiently safe,” Zheng Xiao nonetheless decided to opt out of He Jiankui’s gene-editing project before signing the consent form

Und ich wüsste  gerne in dem Zusammenhang – welches Journal das Manuskript von He zum Review hat. Wer sind die Reviewer?

Das Medienecho wird  geringer, es scheint in Mode zu kommen, Listen aufzustellen. So auch Nature

Is He Jiankui in trouble?
Are He’s claims accurate?
When will there be another gene-edited human?
Will He’s revelations hamper ethical efforts to do germline editing?
How will scientists ensure better oversight of germline editing in future?

Ansonsten geht es heute um die Frage, welches Gen Hi Jiankui wohl bei der zweiten Familie mutiert hat (mutiert ist korrekt, editiert wäre Schönfärberei) STAT hat einen Tipp

The email landed out of the blue. As Dr. Kiran Musunuru was scrolling through his inbox about a year ago, he found a message from a scientist identifying himself as a graduate student at Southern University of Science and Technology in China [Feifei Cheng]. It explained that the lab where the student worked had used CRISPR, the revolutionary genome editing tool, to disable a gene called PCSK9 in human embryos.

Nun, Cholesterin wäre auch ein Designtarget, das wissen aber doch schon seit dem zweiten Registereintrag. Ich hatte gehofft, es würde nicht soweit kommen, aber jetzt ist von dem “China’s Frankenstein” die Rede und zwar von Newsweek.

The scientist was brought back to Shenzhen by the university’s president, Chen Shiyi, Apple Daily reported. Chen is under house arrest on campus, the report said, adding that there were security guards on the university grounds. However, a spokeswoman for the Shenzhen-based Southern University of Science and Technology batted away reports of police arrests, telling the South China Morning Post, “Right now nobody’s information is accurate, only the official channels are.

Die WHO äussert sich ()

Der Chef der Welt​gesund​heits​organi​sation (WHO) hat angesichts der angeblich genmanipulierten Babys in China vor den unbeabsichtigten Konsequenzen solcher Eingriffe gewarnt. Richtlinien sollen erarbeitet werden, um Rahmenbedingungen für mögliche Einsatzgebiete der Methode vorzugeben.
Generaldirektor Tedros Adhanom Ghebreyesus will die Genom-Manipulationen an Keimzellen nicht von vornher- ein als Therapie bei Krankheiten ausschließen. Die WHO berufe jetzt ein Expertengremium ein, um alle Aspekte der umstrittenen Technik zu untersuchen, sagte der WHO-Generalsekretär am Montag in Genf. „So etwas kann nicht einfach ohne klare Richtlinien gemacht werden.“ Genom-Editierung werfe ethische, soziale und Sicher- heitsfragen auf, sagte Tedros.

Jetzt ist auch noch das Werkzeug schuld / Wired.

The documents named Massachusetts-based Thermo Fisher Scientific as the supplier of Cas9—the bacterial protein that clamps onto DNA and delivers a double-stranded slice—and Bay Area startup Synthego as the maker of its synthetic guide RNA. If gene editing were a butcher shop, Thermo Fisher would craft the knives and Synthego would instruct on which cuts to make.

Aber Spass beiseite, vielleicht kann Synthego CEO Paul Dabrowski mal sagen was He bisher alles bei ihm bestellt hat? Kunden die CCR5 bestellten, bestellten auch PCSK9?

Deem wird weiter verhört (CNN).

Ein Dokumentation über Christiaan Barnard 1967

International hatten sich in den Sechzigern zahlreiche Teams auf Herztransplantationen vorbereitet, besonders in den USA. Zaudern ließ sie eine mögliche Mordanklage, wenn sie einem Patienten das noch schlagende Herz entnommen hätten. Barnard preschte vor und stach alle medizinischen Rivalen aus. Zuvor war der ehrgeizige 45-Jährige praktisch unbekannt, über Nacht wurde er zum Weltstar … Erst 1968 definierte eine Kommission der Harvard Medical School Menschen als tot, wenn sie in einem irreversiblen Koma liegen und das Gehirn bereits zerstört ist.

Donnerstag 6.12.2018

Das Nuffield Council distanziert sich nun auch, es wurde auch Zeit

The possibilities raised by heritable genome editing could have significant implications for individuals and for all of society. We do not know enough about the safety of these procedures or welfare implications. It’s crucial that action is taken now to support research on safety, facilitate public debate, and put in place appropriate governance.
In July, the Nuffield Council on Bioethics published a report on the ethical and social issues raised by heritable genome editing interventions. We concluded that their use could be morally permissible in some circumstances. These circumstances do not, however, exist at present, anywhere. In our report we have discussed what these circumstances might be, but it is now for the wider society to agree them, and to define what governance measures should apply.
We recommended that any use of genome editing interventions should be guided by two overarching principles: they must be intended to secure, and be consistent with, the welfare of the future person; and they should not increase disadvantage, discrimination or division in society. More work needs to be done to establish whether these principles can be met.
Pete Mills, Assistant Director, added:
“Coming on the eve of the second international summit on genome editing, this announcement looks like a cynical attempt to seize headlines. If the claims are true, it is a premature, inexplicable and possibly reckless intervention that may threaten the responsible development of future applications of genome editing.”

Die Bild Schlagzeile heute

ER WILL BABYS GENMANIPULIERT HABEN
Chinesischer Wissenschaftler wird vermisst

bisher gab es nur die verunglückte Formulierung von “Gott gespielt“.

Das ist ja wohl blasphemisch. Gott würfelt nicht. Und Gott spielt nicht. Die chinesische Nachrichtensperre scheint im übrigen zu greifen. Mit etwas Abstand nun auch zwei Pulitzer Preisträgerinnen der NYT

Most importantly, said Dr. Kiran Musunuru, a geneticist at the University of Pennsylvania who reviewed the data, “there’s clear evidence of mosaicism” in the edited embryos of both twins. “I was so furious,” Dr. Musunuru said. “This would have been disturbing anyway — gene-edited babies. It made it a hundred times worse knowing that he had totally mosaic embryos. It’s as if you took the embryos and dipped them in acid and said ‘You know what, I’m just going to go ahead with the implantation anyway.’ It’s not that much different.” While it is unclear if the babies themselves ended up with a mosaic patchwork of cells, Dr. Musunuru said the data shows that Lulu’s placenta was mosaic, which is not a good sign … Dr. He has not submitted his data, nor has he identified the children or parents, other than to provide first names for the twin girls, Lulu and Nana; these may be pseudonyms. We won’t know for many years if Crispr affected genes other than CCR₅. Nor can we gauge the health of the babies now or in the future. And, of course, we do not know if other scientists will be emboldened to try their own experiments editing the genes of human embryos.

Das Business soll weiter gehen, Nature heute

So, how can the gene-editing community set up a better system? A starting point would be a global registry (or national registries) set up by funders or governments to record preclinical research that involves gene editing in human embryos.

He brauchte Security letzte Woche in Hongkong, so Science

For his talk at last week’s summit, He Jiankui was accompanied by security guards because of threats…
On the eve of the International Summit on Human Genome Editing in Hong Kong, China, last week, He, a researcher at nearby Southern University of Science and Technology in Shenzhen, China, had dinner at the city’s Le Méridien Cyberport with a few of the meeting’s organizers. The news of He’s claim had just broken, and shock waves were starting to reverberate. But the reports were still so fresh that the diners sat in the restaurant without being disturbed. “He arrived almost defiant,” says Jennifer Doudna … After more than an hour of questioning, He had had enough. “He just seemed surprised that people were reacting negatively about this,” Doudna says. “By the end of the dinner he was pretty upset and left quite abruptly.” … I got the strong impression that he saw Robert Edwards as a kind of hero, a paradigm breaker, a disrupter, and that he wanted to model himself after that … What’s more, He has not yet tested whether HIV can infect cells taken from the girls.”

China distanziert sich massiv von He (Bloomberg)

Less expected was the reaction of the Chinese government. On Nov. 29, Xu Nanping, vice minister of science and technology, told state TV that authorities had halted work at He’s lab and planned “a comprehensive and objective investigation of the facts of the incident.” Vice Minister of Industry and Information Technology Huai Jinpeng said the government intended to take a “zero-tolerance attitude in dealing with dishonorable behavior” in research and would bar He from a national science award for which he was a candidate.
Those signs that China may restrict genetic research more than previously thought mark a sharp contrast with the country’s approach to artificial intelligence…
An immediate response is needed, Doudna stresses. “I’d love to see the national science academies from several countries within a month come up with a set of draft guidelines that would be somehow affiliated with a RAC-like body,” she says. Daley agrees. “We have to aspire to some kind of a universal agreement amongst scientists and clinicians about what’s permissible,” he says. “Those who violate those international norms are held out in stark relief.”

Freitag 7.12. 2018

Auch die Politik meldet sich nun in Deutschland zu Wort.

Die Kandidatin für den CDU Parteivorsitz

Offensichtlich haben die Eltern auch chinesisches Recht gebrochen (“sperm washing” ist nur in Thailand legal). Sind die Zwillingsmädchen vielleicht auch in Gefahr? In Afrika gibt es eine gnadenlose Hetzjagd auf Albino Kinder.

Einen wichtigen Artikel habe ich übersehen – die NYT mit dem eigentlich ersten, auch schief gegangenen Versuch des Gene Editing.

In their 2001 report on this discovery, they called it “the first case of human germ-line genetic modification resulting in normal healthy children.” The germ line is a lineage of cells that gives rise to a new person. … The F.D.A. was not pleased. It sent the clinics letters demanding that they apply to test the method as if it was a new experimental drug. … So researchers went underground…. In 2016, an American fertility doctor named John Zhang announced that he had gone to Mexico to quietly carry out the procedure on a woman from Jordan with a neurological disease called Leigh Syndrome.

Sieht so aus als hätte die Honkong Konferenz die Slides nicht wie von allen Teilnehmern publiziert. 

Es gibt sie aber auf de Google Drive von Anirban Maitra. Die funktionelle Aufklärung der Mutationen bei Lulu und Nana in der Maus wird schwierig sein, da es das CCR5 hier nicht gibt. Allerdings gibt es eine “humanisierte” Maus aus der HIV Forschung.

Die ZEIT hat eine gelungene Stellungnahme von Thomas Assheuer, das Hauptargument ist bei  Habermas entlehnt “Wie wir mit menschlichem Leben vor der Geburt umgehen, berührt unser Selbstverständnis als Gattungswesen.” (“Die Zukunft der menschlichen Natur”). In seiner Formulierung

Der Schock besteht darin, dass ein Forscher zum ersten Mal in der Geschichte etwas Ungeheures getan hat: Er hat in den pränatalen Anfang eines Menschenlebens eingegriffen und ihn neu programmiert. He Jiankui hat die Grenze zwischen Gewachsenem und Gemachtem überschritten, die Grenze zwischen dem genetischen Zufall der Natur und einem vom Menschen hergestellten Gegenstand. Auch wenn es über Menschenbilder immer uferlos Streit gab, so war doch eines unstrittig: Der Mensch ist keine Sache; die Würde der Person und die Unverfügbarkeit ihrer innersten Natur bilden eine unauflösliche Einheit. Genau das ist nun Geschichte.

Das Beste, was es bisher zu der Ethik auf Deutsch zu lesen gibt, ist das Wortprotokoll des Ethikrates “Zugriff auf das menschliche Erbgut.
Neue Möglichkeiten und ihre ethische Beurteilung
“. 

CRISPR-Sonden und Cas9-Enzyme, diese Wesen zwischen Leben und Nicht-Leben, können in dem nur durch hochtechnische Apparatur erschließbaren, unendlich kleinen Miniaturwunderland von Zellen, DNA, RNA, Bakterien, Viren und Enzymen, DNA-Abschnitte in bisher unbekannt präziser Art ziemlich genau an eine Stelle bringen, einfügen, ausschalten oder verändern, wie es bisher für die Wissenschaftler ungeahnt war.

Bleibt noch ein SZ Artikel “Zweifel an Crispr-Babies“. An der Existenz bestehen wohl weniger Zweifel im Augenblick, mehr an den dubiosen Begleitumständen.

Wie das Wissenschaftsportal Statberichtet, erfuhr Mark DeWitt von der University of California, Berkeley, im September 2017 von He, dass eine klinische Studie zur genetischen Veränderung von Menschen unmittelbar bevorstünde. Ein Ethikkomitee habe zugestimmt, die Paare für das Experiment würden bereits rekrutiert. Warum DeWitt damals nicht Alarm schlug? Hes Mitteilung sei vertraulich gewesen, erklärt der Forscher jetzt. 

Samstag 8.12.2018

Jennifer Doudnas Alptraum

I had a dream recently, and in my dream”—she mentioned the name of a leading scientific researcher—“had come to see me and said, ‘I have somebody very powerful with me who I want you to meet, and I want you to explain to him how this technology functions.’ So I said, Sure, who is it? It was Adolf Hitler. I was really horrified, but I went into a room and there was Hitler. He had a pig face and I could only see him from behind and he was taking notes and he said, ‘I want to understand the uses and implications of this amazing technology.’ I woke up in a cold sweat. And that dream has haunted me from that day. Because suppose somebody like Hitler had access to this—we can only imagine the kind of horrible uses he could put it to.

Ein interview von ihr steht auf Twitter. He Jankui meldet sich auch wieder zu Wort mit einer Email an The Crimson

“I will publish my paper and this question will be answered in my paper” … He sent his email to The Crimson from what appeared to be his official Southern University of Science and Technology email address. He signed the message “JK” — fitting with previous media reports that he sometimes goes by his initials.

Ein wenig sinnvoller Zeitschriftentitel des New Scientist, da wäre es besser das nicht lesen zu müssen wie die LA Times Artikel, die mit einem Paywall alle Europäer aussperren.

Aus der Schweiz SRF “Hat er sie behandelt oder krank gemacht?”

Entwicklungsbiologin Maria Jasin … hält das Experiment für deutlich verfrüht: «Ich glaube, dass dieses Experiment nicht genügend überdacht wurde. Und ich sage bewusst, dass es ein Experiment war, denn eine therapeutische Behandlung ist es nicht.» … Molekularbiologe Dieter Egli, der an der Columbia Universität in New York forscht: «Die Regierungen müssen Entscheidungen treffen. Es ist sehr wichtig, dass man damit jetzt beginnt und es nicht weiter hinausschiebt.» Ansonsten geschehe genau, was jetzt in China passiert ist. «Es gibt Leute, die denken: Ich habe es begriffen und kenne Vorteil und Risiko. Jetzt gehe ich mal voran.»

Sonntag 9.12.2018

Twitter Screenshot

Die Nobelpreisträgerin Christiane Nüsslein-Volhard

Ein schlechter Versuch: Aus der Geburt der chinesischen Zwillinge muss die Wissenschaft Konsequenzen ziehen. Sie sollte begreifen, dass Genveränderungen immer untragbare Risiken mit sich bringen. Ein Gastbeitrag … Die Ausprägung (der Phänotyp) einer Genveränderung hängt ganz entscheidend vom gesamten Genom des Individuums ab, was man daran sieht, dass sich bei monogenen Erbkrankheiten des Menschen identische Mutationen mit sehr unterschiedlichen Krankheitsbildern ausprägen können.

Das st eigentlich ein Argument gegen jegliches Gene-Editing beim Menschen. Zudem findet sie

Vollkommen ins Reich der Utopie gehören Ansinnen, die Züchtung der Menschheit selbst in die Hand zu nehmen und Menschen durch Genom-Editierung besser, größer, klüger oder schöner zu machen. Das geht doch bei anderen Tieren und bei Pflanzen, warum nicht beim Menschen? Ich habe bereits darauf hingewiesen, dass gewünschte Genveränderungen mit großen Zahlen nicht gelungener Versuche einhergehen. Bei genetischen Experimenten mit Mäusen, Fischen, Rindern, Reis oder Rüben wird in hohem Maße Auslese betrieben. Durch Genom-Editierung lassen sich damit jetzt besonders leistungsfähige Nutztiere und Pflanzensorten erzeugen. Hier werden aus einer großen Zahl diejenigen Tiere oder Pflanzen, die die gewünschten Eigenschaften tragen, zur Fortpflanzung ausgewählt – beim Menschen undenkbar. 

Mit entsprechender Zeitverzögerung kommen nun die ersten medizinischen Journals. Der britische Lancet (ist das Richard Horton?) schreibt, dass sich die Welt über Nacht geändert hat.

This was also not a situation of unmet medical need, since there are well-established and effective ways to prevent transmission of HIV or to treat it. Moreover, the role of CCR5 in the immune system is not fully understood, the girls may be more susceptible to other infections. It has become clear that this is really is no more than a human experiment, a proof of concept unlikely to confer any real benefit to the recipients but with unknown and potentially incredibly serious risks … Many experts had suggested that this development was imminent. Were we guilty of looking away and allowing this to happen? … Wilkinson asserts that these researchers have undermined the contract that scientists have with society; that contract allows research in situations where the risk to the patient is clearly calculated and the implications to the community at large have been appropriately considered. … Scientific culture has long been to accredit individuals with steps forward instead of recognising group achievement or incremental progress. This has created an ethos of celebrity in academia, which has sometimes rewarded maverick behaviour. 

Montag 10.12.2018

War doch nur alles Fake? ipscell

He gave a talk at the 2nd international genome editing meeting showing some data in a blur of slides to try to back up his claim. However, the data he presented really proved close to nothing. There’s no way for any of us to know where his sequencing data (shown and not shown) came from biologically. Did the data in fact come from fetal-derived materials and from actual babies as claimed? Or instead did the data come from CRISPR’d stem cells? From embryos that were never implanted? Unless the Chinese government intervenes with an aggressive investigation that includes direct sampling of the twin’s and parents’ DNA followed by independent sequencing, we may never know the truth. If the family doesn’t consent, such government action would be almost certainly be ethically impermissible in my view and I’m not advocating they do it, but without such direct evidence there’s probably no way to be sure what happened.

Dienstag, 11.12.2018

Was so alles noch möglich ist.

Stanford Center

Scenarios illustrating governance gaps in in the report include: – A reckless CRISPR user who develops and markets a probiotic created with genome editing that has serious unanticipated effects for consumers; – An agricultural biotechnology firm conducting dual use genome editing research that lies outside current oversight, but nonetheless could have negative consequences for human health – An intentional release of a gene drive organism from a lab, that while having limited physical harm, feeds a state-based misinformation campaign with large economic impacts – An accidental release of a gene drive organism due to lack of awareness and uncertainty about the risk classifications and protocols for handling new technologies – A terrorist group using commercial firms that lack strong customer and order screening to use genome editing to weaponize a nonpathogenic bacteria – A state-sponsored program to develop biological weapons for new strategic uses, including covert assassination, using largely publicly available research

Stat hat ein abgelehntes Paper von He ausfindig gemacht

ISPR babies” scientist He Jiankui tried to publish a paper describing additional experiments that made heritable changes in the DNA of human embryos, much like those that led to the birth of the world’s first genome-edited humans. But the paper was rejected by an international journal after outside scientists raised concerns about both its ethics and its scientific validity, STAT has learned. Targeted PCSK9 genome editing in embryos by CRISPR-Cas9 system One Sentence Summary: The efficacy and safety of our in vitro and in vivo studies presented here suggest that targeted PCSK9 genome editing in embryos by CRISPR-Cas9 system provides a potential strategy for the prevention and treatment of familial hypercholesterolemia and coronary heart disease. Feifei Cheng1, Kaijing Chen1, Xiaoqing Zhou1, Shuo Song1, Jinzhou Qin2, Yangran Chen1, Rui Chen1, Dikai Zhang3, Chenglu Qin4, Chenyang Si5, Zhijian Wang6, Dayong Hao7, Renli Zhang8, Michael W. Deem9,10,11, Jiankui He1,* 1 Department of Biology, South University of Science and Technology of China, Shenzhen 518055, China. 2 Department of Human Reproductive Medicine Center, Third Affiliated Hospital of Shenzhen University, Shenzhen 518001, China. 3 Department of Gynecology, Department of Human Reproductive Medicine Center Third Affiliated Hospital of Shenzhen University, Shenzhen 518001, China. 4 Department of Obstetrics, Third Affiliated Hospital of Shenzhen University, Shenzhen 518001, China. 5 Yunnan Key Laboratory of Primate Biomedicine Research, Institute of Primate Translational Medicine, Kunming University of Science and Technology, Kunming 650500, China. 6 Department of Cardiovasology, Peking University Shenzhen Hospital, Shenzhen 518036, China.

Das NIH will zwar Forschung einschränken

HIV research halted after NIH freezes acquisition of fetal tissue. Researchers at the National Institutes of Health have been ordered not to acquire new fetal tissue for their research since September, according to Science — the same month the Trump administration began an audit of research using the tissue funded by the NIH and other agencies. The NIH confirmed the suspension on Friday to Science, which reported it affected two NIH labs, including halting an HIV research project.

aber Wired weiss schon wie es weiter gehen wird

Last week, Harvard researchers announced that they plan to edit the DNA of human sperm to see if it’s possible to create IVF babies with lower risks of developing Alzheimer’s later in life.

Ein philosophischer Einwurf

Science with a small “s” is a human enterprise as old as humanity itself. Nibbling on that tasty-looking mushroom and waiting a few hours to see if you get sick? That’s hypothesis testing. Try it a few more times with successively bigger bites, maybe add a bit of open-fire cooking; you’ve got a scientific method going. He’s human experiment is clearly science in this sense. Whether it will become Science with a big “S” remains to be seen. This more rigorous meaning of Science—which seeks to accrue knowledge by progressively, and systematically, reducing uncertainty—has only been around a few hundred years. Its arrival was marked by the development of the scientific paper, published in the pages of peer-reviewed journals.

Die neuen Nobelpreisträger beschwichtigen im Guardian

Winners of this year’s Nobel prize for chemistry say overblown fears about genetically modified foods risk preventing society benefiting from the technology. Prof Frances Arnold, from the US, and Sir Gregory Winter, from Britain, made the comments on Friday ahead of Monday’s presentation of the prize.

Designerbabies wird es angeblich nie geben laut The Conversation

I study the prediction of complex diseases and human traits that result from interactions between multiple genes and lifestyle factors. This research shows that geneticists cannot read the genetic code and know who will be above average in intelligence and athleticism. Such traits and diseases that result from multiple genes and lifestyle factors cannot be predicted using just DNA, and cannot be designed. Not now. And very unlikely ever.

Die Entstehung der (natürlichen) Delta32 Mutation ist immer noch nicht klar

Scientists hypothesize that the mutation gave some sort of advantage to people against the epidemic. This gave these individuals an increased chance of survival and ability to reproduce and pass on the affected allele. Evidence dating the mutation back 700 years ago coincides perfectly with the Black Death. According to this idea, the Black Death drove natural selection in the human population.

Mittwoch 12.12.2018

Hinter einem Paywall, das “Wall Street Journal“.

Scientists Skeptical About Gene-Edited Baby Experiment. Experts who examined the data question whether the Chinese scientist was successful

Genomeweb mit Details

But this is still unclear, according to Ryder. “What we know from the deep sequencing data post-birth of the umbilical cord, the placenta, and the cord blood is that there are two genotypes [in Lulu],” he said. “There’s the -15 mutation and there’s the wildtype or the unedited gene. It could be that in other tissues there will be other genotypes that reveal themselves. Having looked more closely at the chromatograms of the sequencing from before implantation, it suggests that the embryos were in fact mosaic. I would say that it’s probably the case that she’s not going to be protected from HIV, and she could be heterozygous. It’s at least possible that half of the cells are completely edited, and half of the cells are unedited. And whether or not she’s protected depends upon what genotypes are present in her CD4+ T cells which are the cells that HIV infects.” “I have both serious ethical and scientific concerns with Dr. He’s work. The lack of an unmet medical need, the failure to fully engage the communities of stakeholders, and numerous breaches of community and institutional policies and laws represent major ethics violations,” Harvard University and Broad Institute researcher David Liu said in an email interview. “The disturbing lack of correspondence between the DNA sequencing data and the claimed genotypes of the babies, the somewhat superficial off-target analysis, and the lack of characterization of the consequences of the edited forms of CCR5 in these babies raise additional scientific questions that are deeply troubling.”

Donnerstag 13.12.2018

Meine Updates auf Twitter

Historisches bei Riffreporter (paywall)

CRISPR-Beginn: Herr Ishino und die wunderbare Ahnungslosigkeit

Deems Anwalt sagt, sein Klient hätte nichts mit Hes Versuch zu tun

In a statement to Bloomberg on Wednesday, Deem’s lawyers denied that he had ever been involved in human research, including in the Chinese case. “Michael does not do human research, and he did not do human research on this project,” said David Gerger and Matt Hennessy, Houston-based lawyers for Deem.

Nature zur Funktion von CCR5

It has a well-established protective role is in West Nile virus, which is transmitted by mosquitoes and is common in Europe, Africa and the Americas. Although most people infected exhibit no symptoms, about 20% do, with some developing potentially life-threatening complications such as meningitis or encephalitis. Philip Murphy, an immunologist at the National Institute of Allergy and Infectious Diseases in Bethesda, Maryland, has done experiments that show that people without a functional CCR5 gene are four times more likely than those with the gene to develop these serious conditions2. “CCR5 deficiency is not benign,” he says… Studies have found that people with the CCR5-Δ32 are more likely to experience severe encephalitis from tick-borne diseases, and to have a severe reaction to the vaccine for yellow fever.7 “The absence of CCR5 can have severe disadvantages,” says Kaul…Mice without the gene learned to both navigate mazes and remember painful stimuli faster than rodents with the gene6. Overall, deletion of the gene improved the animals’ cognition by 30–60%, says Kevin Fox, a neuroscientist at Cardiff University, UK.

Freitag 14.12.2018

Paul Knoepfler bleibt skeptisch über die Haltung der Akademie

What do National Academies, mtg organizers, etc. really think re: #CRISPR babies? Do some secretly feel happy about He’s claim?

ipscell Was davon ist nur Lippenbekenntnis?

To maintain the public’s trust that someday genome editing will be able to treat or prevent disease, the research community needs to take steps now to demonstrate that this new tool can be applied with competence, integrity, and benevolence. Unfortunately, it appears that the case presented in Hong Kong might have failed on all counts, risking human lives as well as rash or hasty political reaction.

FiftyThirtyEight mit einem Essay wie man verrückte Wissenschaftler stoppen kann.

Doctor Faustus was carried off to hell. Pneumonia and an Arctic ice flow ended Victor Frankenstein. Doctor Moreau’s own creations … Lacking the devil, or a deus ex machina, us nonfictional people are still faced with the challenge of stopping rogue researchers. …The same week that news of He’s experiments came out, the journal Nature ran a story about a team at Harvard that is planning the first real-world experiments in geo-engineering … Legal restrictions on science basically began as a byproduct of World War II. Emerging from the revelations of grotesque Nazi research, the 1947 Nuremberg Code was the first time that anybody really tried to set international rules for what you could and could not do in medical experiments.

Chemical & Engineering News über den Mann der He Jiankui noch hätte stoppen können und sich nun in Ausflüchte versteigt

I think that one of the challenges of having that broad conversation is seeing that this is not just about one guy who did one experiment that produced two children. It’s about a trajectory. And that trajectory is not only about germ-line genome editing. It’s about a whole range of emerging technologies for intervening in and manipulating human life in ways that are in some respects scientifically promising and exciting and in others worrisome.

Samstag 15.12.2018

Bucherscheinung Braun / Schickl / Dabrock: Between Moral Hazard and Legal Uncertainty. Ethical, Legal and Societal Challenges of Human Genome Editing. Das Lulu/Nana Video liegt jetzt bei 318.233 Aufrufen. Off-target Voraussagen beim Mensch sind praktisch unmöglich, so meine Analyse von heute morgen. Manchen englische Ethikern sind zum Fürchten.

Aus den Slides von Peter Mills, Nuffield Council on Bioethics, Hongkong.

Aber wir wissen ja, dass die Engländer bei E&E (Europe&Ethics) hier anders ticken. Wie ist es zu bewerten, dass trotz des ähnlichen oder gar gleichen Kulturkreises das Genome-Editing in Großbritannien und Deutschland unterschiedlich gehandhabt wird?

„Man muss mit dem Pluralismus konkurrierender Ethiktraditionen in Europa umgehen“, antwortete Graf. Die Rede vom gemeinsamen Kulturkreis sei auch insofern nicht unproblematisch, als es bekanntermaßen sehr unterschiedliche geistesgeschichtliche Hintergründe der Argumentationen in beiden Ländern gebe. Insgesamt, so Seibert- Fohr, könne man nur „auf den Konsens aufbauen, den wir in Form der Menschenrechte“ haben.

Angeblich hat He Jiankui auch die falsche Ethik-Kommission gefragt, soll jedenfalls  Y.M. Dennis Lo, The Chinese University of Hong Kong, gesagt haben.

Das Hastings Center über die Unterschiede zwischen chinesischer und westlicher Ethik.

Is this really the right way to look at things? Our answer is, no. The evidence doesn’t bare these beliefs out; it is a misdiagnosis, and it risks obscuring the real issues that He Jiankui’s experimentation raises. Since the news on the gene-edited babies came out on November 26 via Baidu and Google, one of us (Nie) has been closely following reactions to it in journalists’ reports, commentaries, and posts on Chinese and international mass media, as well as on China’s major social media platforms, Weibo and WeChat. The belief that China is ethically distinct from the West might suggest that He’s news has been widely or even universally welcomed in China. But this is simply false. Almost immediately after He’s announcement, 122 Chinese scientists issued a passionate public statement that they “Firmly oppose!!!” and “Strongly condemn!!!” He’s acts (exclamation marks included in the statement). Within a few days, more than 300 other Chinese scientists and scholars set out to confront the issues through “Ten Questions to He Jiankui.” These two documents have since been widely circulated via mass media and social media… The general public in China are remarkably similar to the words used in the Western media about He’s experiments. They include more restrained terms such as “unethical,” “immoral,” “wrong,” “irresponsible,” and “reckless.” They also include stronger and more emotive ones: He has been described as “mad,” and a “scientific lunatic,” and his experiments as “monstrous,” “disgusting,” “repulsive,” “inhuman,” “cruel,” “horrible,” “barbaric,” and “atrocious.”

Sonntag, 16.12.2018

New York Times über den Protest von Künstlern an der Technik und was chinesische Zensoren dazu sagen

The artists, from Europe, Australia and the United States, were not given an official reason why their works were rejected for the show, which opens on Dec. 21 at the Guangdong Museum of Art. The pieces did not touch on the Tiananmen democracy crackdown of 1989, independence for Taiwan or Tibet or the private wealth of Chinese Communist Party leaders — topics that are widely known to be off-limits for public discussion in China… Against that background, a work like “T3511” by Ms. Dewey-Hagborg with Toshiaki Ozawa would seem to be especially timely.

Noch mehr Kunst? Oder nur ein Spinner? “The first injection“? Ich hätte dafür eher Ex 2,11 oder Ex 4,11 genommen.  Die Frühform der IVF  in Gen 30,3 oder den ersten Gentechnikversuch in Gen 30,25 ;-)

Ein mehr allgemein gehaltener Podcast des Guardian.

Montag 17.12.2018

STAT bleibt an dem Thema dran, Doudna über das Hongkong Dinner

“His demeanor was an odd combination of hubris and naivete,” she recalled in an interview. “He was very confident in his work, and totally not understanding what an explosion he had caused” — one that, some scientists feared, could derail hopes for using CRISPR to prevent some of the most devastating diseases lurking in the double helix…In the room they shared, He and Haeussler talked shop, including how to detect off-target edits and how deeply He probed to find any. One red flag was that He was doing what’s called “short read sequencing,” meaning he sequenced short segments of DNA. That can miss big rearrangements along a chromosome…He did not list the trial on China’s official trials registry until Nov. 8, 2018, which is thought to be the birthdate of Nana and Lulu… In all, they injected 31 embryos, succeeding with 21. Analyses of cells when the embryos were 3 to 5 days old revealed a mishmash of edits. None replicated the CCR5 mutation known to protect against HIV. With the parents’ permission (He said they understood the genetic niceties), He implanted 11 of them anyway….and seemed not to understand why that was such a great leap beyond the embryo experiments he did talk about…”

Interessant hier das erstmal der berechtigte Einwand, nicht nur shot gun zu sequenzieren, sondern auch nach Rearrangements mit Array CGH/CMA zu suchen.

Kein Wunder, dass die New York Times langsam Weltuntergangsstimmung verbreitet.

Would Human Extinction Be a Tragedy?
Our species possesses inherent value, but we are devastating the earth and causing unimaginable animal suffering.

Wenn man sich das CSH Asia Programm ansieht

Dienstag 18.12.2018

Nature wählt He Jiankui zu den Top 10 “Ten people who mattered this year”

He will leave a complicated legacy. Scientists worry that the field of gene editing might now struggle to secure funding, regulatory approval or support from the public. And although the technology could lead to new insights into human development and potentially some ways of preventing deadly genetic disorders, few would argue that He’s approach has helped. “I think he will be judged harshly,” says DeWitt.

Dazu steht er angeblich auch auf der Time 100 Liste. Allein He Jiankui mal persönlich getroffen zu haben – so an der ETH Zürich –  gibt Promi Status.

Der grösste Hörsaal an der ETH Zürich ist gerappelt voll. Die «Crispr-Babies» locken die Studenten in Scharen…Und weil man so wenig weiss über den Forscher und sein Experiment sind die Reaktionen im Hörsaal heftig, als plötzlich ein chinesischer Student das Wort ergreift. Er hat an derselben Universität wie He Jiankui studiert und sass bei diesem in Vorlesungen. Sofort wird der Student in die Runde der Professoren gebeten. «Wir haben gleich ein paar Fragen an Sie», sagt Jacob Corn.

Damit bricht aber nun auch kurz vor Weihnachten das große Medieninteresse ab. Baidu das “Google” Chinas

Donnerstag, 20.12.2018

Nature bringt eine Stellungnahme der chinesischen akademischen Gesellschaften

We were shocked by He Jiankui’s claims last month that twin girls were born from embryos that were gene-edited for HIV resistance. Such work would violate the current code of conduct from China’s ministry of health, as well as internationally accepted ethical guidelines

Die  Chinesen wissen also auch nicht mehr als wir im Augenblick. Die gedruckte Ausgabe des Deutschen Ärzteblatts ist etwas ausführlicher als der Online Beitrag und legt Wert auf die Feststellung “einiger Forscher und Politiker” die “Gentherapie” sei nicht aufzuhalten.  
Leider steht der Artikel nur im Politikteil und es stimmen auch nicht alle Details obwohl von einer Diplombiologin verfasst. Interessant dabei der Verweis auf einen FDP Antrag im deutschen Bundestag.

Die FDP fordert die Bundesregierung unter anderem auf, die Chancen vor den Risiken in der Entwicklung der Humangenetik zu sehen. Neue, innovative Technologien in der Gesundheitsforschung sollten in ihren positiven Auswirkungen nicht durch gesetzliche oder staatliche Regulierung eingeschränkt werden.

Im Video war es da allerdings schon 23:40 und vielleicht gab es auch in der Bundestagskantine schon etwas zu trinken? Zu sehen ist hier eine Herr Brandenburg MdB der FDP bei dem Versuch Crispr (Clustered Regularly Interspaced Short Palindromic Repeats)  und Schinesen  fehlerfrei auszusprechen. Alles gipfelt  in der Frage “Kann ein falscher Weg durch gute Ergebnisse gerechtfertigt werden?” Nun, ich würde  sagen,  ein falscher Weg führt in die Irre. Und Rechtfertigung ist doch gemeinhin eine Bedingung für eine Überzeugung, oder theologisch eine Verhältnisbeschreibung zwischen Mensch und Gott? Vielleicht hat er auch nur die Frage versaut und wollte fragen, ob der Zweck die Mittel heiligt? 

Etwas seriöser der Kommentar von Wolfram Henn im Deutschen Ärzteblatt, der die Motivationslagen Geltungssucht und Gewinnstreben anspricht. Seine Forderungen sind schon richtig law and order

Seriöse wissenschaftliche Fachpublikationen dürfen keine Plattform für unethische Forschungsergebnisse bieten; hierfür gibt es bereits einen breiten internationalen Konsens. Aber auch die Laienpresse tut gut daran, durch ihre Chronistenpflicht keine klammheimliche Faszination am Verbotenen hindurchschimmern zu lassen – daran fehlte es bislang mitunter.
Öffentliche Arbeitgeberwie Universitäten, aber auch Zulassungsinstanzen wie Ärztekammern müssen vorsätzliches Fehlverhalten zeitnah und hart sanktionieren. Die Universität in Shenzhen, an der He Jiankui seine Experimente durchgeführt zu haben vorgibt – er hat von Februar 2018 bis Januar 2021 unbezahlten Urlaub –, muss sich aber kritischen Fragen zu ihrer Aufsichtspflicht gegenüber Mitarbeitern stellen.
Öffentliche Fördereinrichtungen und private Stiftungen, aber auch industrielle Geldgeber müssen vorsätzliche Verstöße gegen ihre Richtlinien mit Rückforderung bereits ausgezahlter Fördermittel aus dem Privatvermögen des Täters oder der Täterin sowie mit institutionsübergreifendem dauerhaftem Ausschluss von künftiger Unterstützung ahnden. Die Deutsche Forschungsgemeinschaft hat dazu eine schon seit Jahren bewährte Verfahrensordnung, aber auch international ist eine Vernetzung nicht nur von Forschungsprojekten, sondern auch der robusten Durchsetzung ethischer Standards unverzichtbar.
Sollte aus dem Fehlverhalten materieller Profit resultieren, etwa Zulauf von Patienten oder Aufträge für kommerzielle Laborarbeiten, muss das im Wirtschaftsstrafrecht etablierte Instrument der Gewinnabschöpfung eingesetzt werden: Verstöße gegen ethische Prinzipien dürfen sich weder direkt noch indirekt finanziell lohnen.

Freitag, 21.12.2018

Neuigkeiten zu dem Doktorvater Michael Deem

Who is He Jiankui’s mentor Michael Deem & is he trying to edit himself out of CRISPR baby project? … I recently emailed Deem to ask for clarification on his role, but got no reply. If Deem won’t discuss his work openly at this point then we’re all kind of left in the dark to speculate and need to rely on already existing media reports.

Samstag, 22.12.2018

Mitstudenten melden sich zu Wort, hier ein phänomenaler Insider Artikel, der akribisch die Vorgänge zusammenfasst und nicht ganz so China freundlich ist wie das Hastings Center am 15. oder die offizielle Stellungnahme am 20.12.

I have raised serious concerns about the dangers of China’s techno-nationalistic ambitions and the country’s poor record in scientific ethics…the story that emerges is more Elizabeth Holmes than Dr. Frankenstein. It is a story in which high-tech ambition meets capitalism with Chinese characteristics … first major setback in 1998. The exposure of a variety of medical frauds led to a nationwide crackdown … it was not uncommon in 1990s China for an entire village economy to be centered around one commodity and a fanatic race to fortune … He’s appetite for publicity was already evident during his time at Rice. … significant space to a report on his wedding in 2010, under this headline: “With outstanding morals, excellent academics, and infinite potential, a union for life complete with both good looks and scholarly talent.” … The scientist He Jiankui from Shenzhen, China, announced that a pair of gene-edited babies named Lulu and Nana were born in China this November, both healthy.” So began an article from the People’s Daily online, the Chinese government’s official mouthpiece. The article went on to state the significance of the news: “These are the world’s first genome-edited babies who are immune to HIV. This also means China has achieved a historic breakthrough in applying gene-editing to the prevention of disease.” … Is China the “Wild East” of bioethics? With its first ethics committee established by the Ministry of Health in 1998, the history of modern bioethics in China is short, and its record is tainted with fraud, corruption, and mad scientists.

Dumm nur, dass das Internet nichts vergisst und der People’s Daily Artikel archiviert wurde. Was bleibt?

He’s gene-editing experiment would constitute a serious case of regulatory failure in the world’s most powerful surveillance state.

Es bleiben daraus nur ein Schluss: die Überwachung hat nicht funktioniert (oder sie sollte nicht funktionieren, wahrscheinlich ist es eh nicht soweit her damit, kein Wunder wenn da auch BMW, VW und andere Betrüger an Bord sind).

DIe Schweizer Ethikratspräsidentin Andrea Bücher hat eine Feststellung, auf die ich schon länger warte

Vielmehr analysiert sie, wie sich die Einschätzungen der Ethikgremien weltweit in kurzer Zeit verschoben haben. «2016 galten solche genetischen Eingriffe in die menschliche Keimbahn als rote Linie, die keinesfalls überschritten werden darf», sagt sie. «Keine drei Jahre später schliessen die teilweise gleichen Gremien solche Genveränderungen nicht mehr grundsätzlich aus.»

Montag, 24.12.2018

Der Spiegel meint (paywall)

Die Welt erregt sich über einen Tabubruch: die ersten Gentech-Babys aus China. Dabei hat die Zukunft des Embryodesigns längst begonnen

Österreich distanziert sich

Die Österreichische Akademie der Wissenschaften (ÖAW) hat anlässlich dieses Falles nun eine Stellungnahme veröffentlicht, in der sie sich klar von jeglicher Art des Human Enhancement, also der genetischen Optimierung und Verbesserung des Menschen, durch Methoden wie CRISPR distanziert. Die Durchführung von Versuchen an Menschen ohne vorherige Erlaubnis und ethische Begutachtung durch die zuständigen Einrichtungen sowie unter Missachtung sowohl der örtlichen rechtlichen Bestimmungen als auch des internationalen Konsenses der wissenschaftlichen Gemeinschaft sei eindeutig abzulehnen, heißt es darin.

Sean Ryder hat einen Artikel geschrieben, allerdings stimmt die Annotation nicht ganz, es gibt einen Dreher bei -15. Auch hat der +1 Genotyp einen weiteren Membrandurchgang.

Dazu eine weitere Homestory von Wired über Doudna und die Studentin Lee

“I think there’s a really slippery slope between therapy and enhancement,” Lee says. “Every culture defines disease differently.” One country’s public health campaign could be another’s eugenics.

Wired erinnert an Eugenik

… all children are vulnerable to discrimination based on factors beyond their control—including circumstances shaped by artificial reproductive technology.” … we’ll end up with a society dramatically altered through eugenics, with generations of people engineered to fit a single vision of perfection. It’s an unequivocally scary prospect … It might seem strange to group He’s experiment alongside the more common genetic procedures parents use to ensure their offspring don’t inherit diseases. Yet both exist within a system in which—generally—only the economically privileged are able to pay for treatment to alter the traits that their offspring will and won’t inherit. The danger isn’t in the procedure itself, but who has access to this type of medicine—and right now that group is limited to those who can pay.

Dienstag, 25.12.2018

Kathrin Zinkants Aussage in dem ersten Artikel in der SZ wollte ich noch überprüfen, v.a. die Aussage ob Kathy Niakan wirklich als erste europäische Wissenschaftlerin 2015 die Erlaubnis erhielt, menschliche Embryonen zu Forschungszwecken genetisch zu verändern und es Shoukhrat Mitalipov war, der als erster publizierte. Denn nicht alle “Twitter” Wissenschaftsjournalisten wissen wirklich, worüber sie schreiben

sgRNAs selbst zu gestalten, aber ob sie dann auch funktionieren und nicht gleichzeitig an unerwünschten Stellen im Genom herumschneiden, muss erst in ausgiebigen Vorexperimenten geprüft werden. Dazu kommt, dass nur wenige Gene so gut untersucht sind, dass selbst Fachleute im Voraus sagen können, welche Effekte eine Manipulation im Menschen hätte. Selbst zu jenem Gen, das He Jiankui in den Babys verändert haben will, kommen immer neue Erkenntnisse hinzu. Zum Beispiel jene, dass die Träger eines solchen veränderten Gens schwerer an Influenza erkranken…Eine Menschenzucht, wie sie sich mancher in diesen Tagen ausmalt, ist eben doch alles andere als ein Kinderspiel.

gRNA ist der Oberbegriff, den ich hier verwendet hätte. sgRNA steht für single guide, vereinzelt auch für small oder short guide RNA, und ist in der aktuellen Nomenklatur das Composite aus crispr RNA (crRNA) das an die tracrRNA (das Gerüst für die Cas Nuclease) angeheftet wurde.
Ich verstehe nicht recht, welche “ausgiebige” Experimente sie meint – die aktuelle Situation ist doch so dass nur 1/10 der Doppelstrangbrüche  korrekt repariert wird, man also immer an Tochterzellen überprüfen muss, was passiert ist.
Und natürlich können wir vorhersagen können, welche Auswirkung eine Mutation im menschlichen Genom hat (-> OMIM oder NCBI Clinvar). Ob das , u.a. wegen des genetischen Backgrounds immer stimmt, ist eine andere Frage.
Es ist aber wohl nur für die Journalistin eine neue Erkenntnis ,  dass CCR5 Defekte den Influenza  Verlauf beeinflusst, das Problem kennt man seit 20 Jahren. Nicht umsonst hat die SZ Redaktion auch den grössten Bock schon berichtigt.

Anmerkung der Redaktion: In einer früheren Version des Artikels wurde behauptet, dass Menschen mit der im Text geschilderten genetischen Veränderung weniger an Grippe erkranken würden. Das Gegenteil ist der Fall. Das veränderte Gen schützt zwar vor einer Infektion mit dem Aidserreger HIV, steht zugleich aber in Zusammenhang mit schwereren Krankheitsverläufen der Grippe. Wir bitten den Fehler zu entschuldigen.

Ihr neuester SZ Artikel fliegt noch höher “Der Mensch steht an der Schwelle eines neuen Zeitalters”

Der Mensch ist durch moderne Gentechnik in der Lage, seine Evolution in die eigene Hand zu nehmen. Er kann gezielt tun, was bislang weitestgehend dem Zufall und der natürlichen Auslese überlassen war, er kann sich vorteilhafte Eigenschaften verleihen und unvorteilhafte Merkmale auslöschen, direkt im Erbgut, weil er es will.

Von einem missglückten Gentherapie Versuch zu der Evolution der Menschheit ist es ein weiter Weg. Will man sich wirklich auf so eine Argumentation einlassen? Nach den aktuellen Prognosen wird die  Überbevölkerung oder der Klimawandel doch vorher alle Mutanten ersticken.

Ausgerechnet in der Woche, in der He Jiankui die Welt den Crispr-Baby-Schreck einjagte, fand mitternächtlich sogar eine Bundestagsdebatte zum Thema statt. Die FDP hatte den Antrag gestellt, Chancen vor Risiken zu sehen und die neue Gentechnik politisch zu umarmen. Über ein Antragsbashing ging die Debatte aber nicht hinaus. Was umso bedrückender ist, als dass alle Redner gut informiert erschienen. Sie wussten um die Unterschiede zwischen individuellen Gentherapien und einem vererbbaren Eingriff in die Keimbahn, sie hatten auch die Ereignisse in Hongkong wahrgenommen. Die entscheidende Frage nach einem Umgang mit den Möglichkeiten aber ließen sie aus, sie verwiesen auf die Einigkeit in der Wissenschaft, dass solche Menschenversuche abzulehnen seien. Was so aber nicht stimmt. Der Mehrheit der Wissenschaftler geht es allein um den Zeitpunkt, und wer sich mit Crispr und seinen Fähigkeiten befasst, weiß, was auf die Menschheit zukommt. Man kann es verdammen oder begrüßen: Auch ganz ohne den Einfluss eines außerirdischen Monolithen steht der Mensch an der Schwelle eines neuen Zeitalters, das nicht allein durch künstliche Intelligenz geprägt sein wird, sondern massiv durch die Gentechnik. Es obliegt dem menschlichen Willen, diesen Schritt zu gestalten. Oder, um es mit Harari zu sagen: “Die wichtigste Frage der Menschheit ist nicht: Was dürfen wir nicht? Sondern: Was wollen wir werden?”

Gut, dass Zinkant weiss, worum es der Mehrheit der Wissenschaftler geht, ich weiss es nicht. Und rhetorische Fragen? Dienen nicht dem Informationsgewinn, sondern sind sprachliche Mittel der Beeinflussung, sagt Wikipedia. Lässt der Autorin allerdings jede Freiheit, später zusagen “das habe ich doch nicht gesagt”.

Ich werde im nächsten Jahr in einem Artikel mal den theologischen Hintergrund untersuchen, wie das Menschenbild in der Genesis (als Spiegel des Gottesbildes) zum Menschenbild der Neo-Genesis wurde . Die Neo-Genesis ist eigentlich nichts anderes als Spiegel der technischen Machbarkeit, übermalt mit pseudomedizinischen Argumenten.

Die SZ hat ein nicht repräsentatives Meinungsbild (N=995)

Liebe SZ Redaktion, der Antipode zu “ethisch nicht vertretbar” ist nicht “wichtiger medizinischer Fortschritt”. So ist das intendierte Wahlfälschung.

Mittwoch 26.12.2018

Nature hatte schon vor ein paar Tagen eine Liste chinesischer Strafmassnahmen für wissenschaftliches Fehlverhalten.

Freitag 28.12.2018

Der Ärztekammer Präsident: “Genveränderter Mensch muss ein Tabu bleiben”

In einem Interview des General-Anzeigers sprach er von einem sehr gefährlichen Spiel. Es strahle die Botschaft aus, dass Forscher „aus Ruhmsucht oder aus materiellem Streben“ alles machten, was möglich sei. Der BÄK-Präsident forderte einen „verbindlichen Kodex“ dafür, welche Forschungs­projekte mit medizinisch-ethischen Standards vereinbar seien und welche nicht. Ein entsprechendes Papier sei in Arbeit. „Wir müssen sicherstellen, dass die Erschaffung genveränderter Menschen ein Tabu bleibt.“ 

Samstag 29.12.2018

NYT

On Wednesday, Dr. He was seen pacing up and down the balcony of his guesthouse, gesticulating in the air. At other moments, he could be seen talking to a woman who appeared to be his wife, who was carrying a baby swaddled in a white cloth. Two balconies attached to his apartment were fenced off by metal wiring … Dr. He is allowed to make phone calls and send emails. Chen Peng, another co-founder of Vienomics, said he spoke to Dr. He several days ago about company matters. “He is safe,” Mr. Chen said. “But I don’t know his exact whereabouts or what state he is in.”

Wallstreet Journal

Chinese scientists have raced ahead in experimenting with gene-editing on humans in the last few years, using a powerful new tool called Crispr-Cas9 to edit the DNA of dozens of cancer patients. Information gathered by The Wall Street Journal shows one such trial has lost touch with patients whose DNA was altered, alarming some Western scientists who say subjects should be monitored for many years … Jennifer Doudna, a biochemistry professor at the University of California, Berkeley and one of the inventors of the gene-editing tool, said long-term monitoring of subjects is vital and failure to medically investigate deaths is unacceptable.

Mittwoch 2. Januar 2018 Im Newsfeed heute eine Theologin

Die Theologin Elisabeth Gräb-Schmidt hat die Geburt der mutmaßlich ersten genmanipulierten Babys als “skandalöses Vorgehen und nicht hinnehmbar” kritisiert.

Leider finde ich keine Begründung in dem Artikel, warum  das Vorgehen für sie nicht hinnehmbar ist. Meine eigener Vortrag am 24. wird vier Gründe ausführen: Geringer Nutzen, hohes Risiko, fehlender Zustimmung der Hauptperson, sowie Ablehnung durch Wissenschaft und Gesellschaft.

Ausserdem hatte ich heute die Frage zu beantworten, warum Jiankui He sich gerade AIDS herausgesucht hat. Er selbst begründet das mit der persönlichen Betroffenheit der AIDS Dörfer in Henan. Ich würde sagen, es war dazu die einfache technische Machbarkeit, es gab zuvor schon Studien mit somatischer Gentherapie des CCR5 im New England Journal 2014 und 2016 im Lancet. Hier hat er sich als Trittbrettfahrer drangehängt.

Donnerstag, 3. Januar 2018

Benjamin Hurlbut in Nature greift das Argument von Andrea Bücher wieder auf – es ist mehr oder weniger feige, das Experiment von Jiankui He nur deswegen zu verurteilen, weil es stümperhaft ausgeführt wurde.

In calling for standards for producing such ‘CRISPR-edited’ babies, these leaders have shunted aside a crucial and as-yet-unanswered question: whether it is (or can ever be) acceptable to genetically engineer children by introducing changes that they will pass on to their own offspring. That question belongs not to science, but to all of humanity. We do not yet understand what making heritable genetic alterations will mean for our fundamental relationships — parent to child, physician to patient, state to citizen and society to its members.
In 2015, the dozen bioethicists and scientists who organized the first International Summit on Human Gene Editing agreed. They said it was irresponsible to proceed with heritable human genetic alteration until two conditions were met: one, that safety and efficacy had been demonstrated; and two, that there was “broad societal consensus” about the appropriateness of proceeding.
Yet just over three years later, the summit leaders seem to have abandoned the commitment to societal consensus, and thus to ensuring that science’s agenda is informed by the wider human community. By guiding genome editing into the fertility clinic, summit leaders are making the wrong judgement call: they are saying, in effect, that He’s experiment was problematic not because of what he did, but because of how he did it.

Der breite gesellschaftliche Konsens fehlt in der Tat. Und da es alle angeht, reicht da auch nicht die einfache oder absolute Mehrheit. Ich lege hier schon mal ein Veto ein, dass niemand sagen kann, es würde einen gesellschaftlichen Konsens geben.

Die chinesische Wissenschaftspolitik findet sich sehr gut beschrieben in einem früheren ZEIT Artikel 

Aus westlicher Sicht wirkt die chinesische Forschung mitunter so abgeschieden und nebulös wie Kexue Dao. Das soll sich ändern: Bis 2050 will China zur “führenden Wissenschaftsmacht der Welt” werden, das hat die Regierung in einer Nationalen Richtlinie festgelegt. Präsident Hu Jintao hat dafür einen Slogan ausgegeben: zizhu chuangxin – “unabhängige Innovation”. Seit 1999 hat das Land seine Investitionen in die Forschung jedes Jahr um 20 Prozent gesteigert; 2008 lag es bereits auf dem dritten Platz weltweit, nur die USA und Japan gaben mehr für die Wissenschaft aus.

Donnerstag, 10.1.2019

He hat nicht auf meine Email geantwortet. Robin Lovell-Badge hat er allerdings geantwortet, um zu rechtfertigen, dass die CCR5Δ32 Deletion keine Nebenwirkungen hätte.

Ausserdem glaubt He weiterhin, beide Kinder seinen geschützt und zitiert PMC114139/ In der Originalarbeit steht

This result suggested that CD4 cells from individuals heterozygous for CCR5- 893() had reduced sensitivity to infection with HIV-1 R5 strains.

“reduced sensitivity” ist nicht “confirmed to provide protection” (ich habe auch schon mal über CCR5 Genotypen gearbeitet). 

Laut stat seien die Wachen vor dem Haus nur zu seinem Schutz sagt er zu  dem etwas ominösen “Stanford University neuroscientist and bioethicist Dr. William Hurlbut”.

“I didn’t pick up any anxiety from JK about what’s going on,” said Hurlbut, using He’s nickname. “He didn’t convey to me that he finds the guards a constraining force at all, but instead feels they are protecting him.”

12.Januar 2018

Nicht ganz klar wann, wohl schon im letzten Jahr, aber das chinesische Register hat nun den Antrag 32758 zurückgezogen .

Sonntag 13. Januar 2019

Zinkant von der SZ – wir kennen sie schon –  meldet sich wieder zurück mit lauter Konjunktiven und dem längst aufgeklärten Gerücht der Todesstrafe. Es geht auch nicht um im verborgenen durchgeführten Versuche sondern um die Implantation. In ihrem Artikel ist im übrigen frei erfunden, dass He bereuen würde. Im Original heisst es lediglich

Hurlbut said He has expressed second thoughts on whether the CCR5 gene was an appropriate target.

auf deutsch: “Er äussert Zweifel, ob CCR5 ein gutes Ziel war.”

Montag, 14. Januar 2019

Die 10 Krimsky Regeln, die He gebrochen hat, nun in nature biotechnology: kein internationaler Konsensus, keine Vorversuche, off-targets nicht suffizient untersucht, keine Risikominimierung, nationale Recht gebrochen, keine Ethik Kommission der Universität, kein Defekt bei den Kindern behoben, Bezahlung der Eltern, Informed Consent ohne Alternativen und Verschweigen von Interessenskonflikten.

Mittwoch, 16. Januar 2019

Eigentlich ist mit dem nature biotechnology Artikel schon alles zur Ethik gesagt, aber evangelisch.de weiss nun von einem bevorstehenden Statement des neu zusammengesetzten Ethikrates im März. In Köln war wohl eine Podiumsdiskussion

Lob-Hübepohl dagegen stellte sich klar hinter das deutsche Embryonenschutzgesetz. Zwar räumte auch er ein, dass es keine einfachen Antworten auf die Fragen gebe, ob Krankheiten wie Mukoviszidose oder Formen der Alzheimer-Demenz nicht auch mit genetischen Therapien bekämpft werden dürften. Im Fall der beiden Babys aus China sei es dagegen so gewesen, dass die Genmanipulationen auf den Wunsch der Eltern zurückgegangen seien. “Die Eltern entscheiden aber nicht für sich. Sie akzeptieren das Risiko. Aber sie müssen die Folgen nicht tragen. Die Folgen trägt das Kind. Das hat keiner gefragt.”

Ja und nein, denn Eltern entscheiden immer über ihre Kinder ;-) Ob die Genmanipulation auf den Wunsch der Eltern zurückgegangen ist? Das weiss niemand. Die Vermutung halte ich aber für abwegig. Die Eltern wusste doch nicht, dass so etwas technisch möglich ist, sie wollten einfach ein gesundes Kind und konnten sich die IVF nicht leisten. 

Donnerstag, 17. Januar 2019

Der DLF mit etwas Verzögerung, aber nichtdestoweniger lesenswert: “Zwei Babys, viele Fragen” mit dem EKD-Ratsvorsitzenden

„Genetische Eingriffe auf die Keimbahn wirken sich auf alle Nachkommen aus. Damit öffnet sich die Tür für das gezielte Formen, das gezielte Design eines zukünftigen Menschen. Es ist – so drastisch muss man es sagen – der Einstieg in die ‚Menschenzüchtung‘. Ein solcher Eingriff in das menschliche Leben stellt sich zum Widerspruch, das den Menschen als Bild Gottes sieht, das sich der menschlichen Verfügbarkeit entzieht.“

Freitag 18.1.2019

Jetzt erst habe ich eine Veröffentlichung im Stern 50/2018 geschickt bekommen, die es sogar auf das Titelbild geschafft hat. Gut geschrieben von Frank Ochmann, nur der Frankenstein Titel ist etwas misslungen.

Dann gibt es noch einen neuen Podcast, der sich an Geschichtsklitterung versucht, denn AP hat die Geschichte nicht als erstes gebracht.

Meinen ersten Vortrag zu dem Thema werde ich am nächsten Mittwoch um 9:00 in Großhadern halten (auf Englisch) und am Donnerstag um 20:00 in Gröbenzell (auf Deutsch).  Aus den 10 Krimsky Regeln mache ich allerdings 15, unterstrichen sind dabei die Argumente die ich für unüberwindbar halte.

Vor dem Vortrag muss ich erstmal noch alles über die deutsch/chinesische Beziehungen und die “drei Lehren” nachlesen. Alles was ich seit der religionswissenschaftlichen Vorlesung 1990 in Marburg vergessen habe.

Montag, 21 .1.2019

Die Ergebnisse der chinesischen Regierungskommission liegen vor und die Nachrichten überschlagen sich heute.

Xinhua.net (eine der zwei offiziellen chinesischen Nachrichtenagenturen in der Übersetzung meiner anonymen Quelle) veröffentlichte die Nachricht zuerst:

The investigation team from Guangdong province has concluded that Prof. Jiankui He, who is affiliated to Univ of South Technology, performed human embryo gene modification for reproduction purpose, which is forbidden in China. Investigation has also found Dr. He self-funding, supervision evasion (?) According to the investigation, since July 2016, Dr. He privately established research team, including foreign personnel, evaded supervision deliberately and carried out human embryo gene modification for reproduction purpose, which is forbidden by China’s law. From March 2017 to November 2018, Dr. He falsified ethic committee approval by others and recruited eight volunteer couples (husbands are HIV positive and wives are HIV negative). To evade the regulation that HIV carriers cannot take assisted reproduction, Dr. He instructed others to provide blood sample for the volunteers. He also instigated people to perform human embryo gene modification and embryo implantation. At the end, two women were conceived, one of them gave birth and the other one is in pregnancy. Among the rest six couples, one quit, the other five didn’t conceive. He’s actions have severely violated ethics, scientific integrity, regulations and laws, causing harmful impact. Dr. He and people involved in this incident have been transferred to Public Safety Agency for further investigation. The new born babies and the volunteers will receive medical observation and follow-up from Guangdong province government.

Dann folgte kurz darauf die South China Morning Post mit nahezu demselben Wortlauf

The special investigation team from Guangdong province said He also raised funds and organized the experiment by himself to conduct the experiment in pursuit of personal fame. These actions directly violated China’s regulations against using gene-editing technologies on human embryos for reproduction purposes. The team said the experiment has seriously violated relevant national regulations, and led to outrage both domestically and abroad. Therefore, He, along with other personnel and institutes involved in the experiment, will be severely dealt with in accordance with laws and regulations. Their relevant crimes have also been reported to public security bodies.

Antonio Regalado hat dazu auf rbmsociety.com in einem Supplement eine juristische Einschätzung aus China gefunden. Der Link geht auf http://www.moh.gov.cn, meine automatisierte Übersetzung auf ChineseRegulations.

Beijing Youth Daily

Recently, a reporter from Beijing Youth Daily interviewed Shao Feng, an insider and academician of the Chinese Academy of Sciences in the field of life science research, in an attempt to explore the scientific significance of the event and its underlying factors.

Damit ist das Experiment also nun heute bestätigt. Ich bin allerdings skeptisch, ob die Unterschriften wirklich gefälscht sind.

Das Interview mit Shao Feng ist dubios vom fehlerhaften Englisch mal abgesehen. Vom Veröffentlichungszeitpunktes würde ich es aber als vermutlich autorisiert ansehen.

The best way to deal with it is to never let the two children know.
Beiqing Daily: Now the question is, as a gene editor, two children have been born. What should we do in the future?
Shao Feng: This is very, very difficult. Now the industry is also discussing whether it is necessary to pay a sum of money for the parents of the two children to live in places that nobody knows, and then the Department tracks them, just like installing GPS positioning. In fact, the biggest challenge is whether the two girls can get married in the future. If we want to get married, we will inherit our children.
Beiqing Daily: Do you think they are allowed to get married? Shao Feng: There is no answer to this.

Die Partei (Industrie?) will die Kinder also mit viel Geld und einer neuen Identität ausstatten. Wie das wohl gehen soll – gleichzeitig überwachen und geheimgehalten? Die Fortpflanzung verbieten würden heissen, es käme zu einer Zwangssterilisation der Mädchen.

Dienstag, 22.1.2019

Auch die SZ hat die Nachricht entdeckt, und bringt die Reaktion von irgendwelchen Genetikern dazu. Gibt es in München sonst niemand der sich mit dem Thema auskennt?

Die USTC feuert He Jiankui in einer knappen Ankündigung.

Unklar bleibt die juristische Aufarbeitung.

Mittwoch, 23.1.2019

Heute wurde ein weiterer Spindelzelltransfer bekannt (Kinder mit 3 Eltern), eigentlich in Spanien verboten, deshalb in Griechenland durchgeführt. 

Researchers from the Spanish centre Embryotools —with headquarters in the Barcelona Science Park (Parc Científic de Barcelona, PCB) — are participating in a landmark scientific event in Greece that will shape the future of assisted reproduction. In a pilot clinical trial conducted on women, which is being sponsored by the assisted reproduction centre Institute of Life in Athens, Spanish scientists have achieved the world’s first pregnancy that uses the Maternal Spindle Transfer technique to solve problems of infertility.

Weitere Details auf Details auf  statnews.com

Donnerstag, 24.1.2019

So geht es auch heute weiter: Die chinesischen Affenversuche sind vom ethischen Standpunkt nicht minder problematisch

The first cohort of five gene-edited monkey clones made from fibroblasts of a monkey with disease phenotypes were born recently at the Institute of Neuroscience (ION) of Chinese Academy of Sciences (CAS) in Shanghai. The expression of BMAL1, a core circadian regulatory transcription factor, was knockout in the donor monkey using CRISPR/Cas9-mediated gene editing at the embryo stage, and the fibroblasts of the donor monkey were used to clone five monkeys using the method of somatic cell nuclear transfer, the same method that generated Zhong Zhong and Hua Hua, the first two cloned monkeys, last year. This major advance, reported on-line in two articles in the journal National Science Review on January 24, demonstrates that a population of customized gene-edited macaque monkeys with uniform genetic background will soon be available for biomedical research.

Ob da die aktuellen Regulationsversuche nicht zu spät kommen?

But most agree major health and science institutions should act quickly. The World Health Organization is assembling a panel to develop global standards for governments to follow. Leaders of the National Academy of Medicine and the National Academy of Sciences in the United States, along with the Chinese Academy of Sciences, have jointly proposed a commission with academies in other countries to develop criteria so scientists can’t “seek out convenient locales for conducting dangerous and unethical experimentation.” The proposal included establishing “an international mechanism that would enable scientists to raise concerns.” The World Economic Forum in Davos has scheduled a discussion of the issue on Thursday.

Savulescu hat es als russisches Genetik Roulette bezeichnet.

Freitag 25.1.2019

Nun wird wieder in den USA ein Moratorium diskutiert, ohne dass allerdings Mehrheiten in Sicht sind.

Samstag 26.1.2019

Das Mitglied im Deutschen Ethikrat, Alena Buyx stellt fest:

Aus meiner Sicht gibt es keine fundamentalen Einwände gegen diese Art von Keimbahn-Eingriffen. Allerdings muss sehr genau darüber nachgedacht werden, welche dieser Einsatzgebiete hochrangig genug sind. Natürlich dürfte es keine andere Möglichkeit geben, die Erkrankung zu vermeiden oder zu heilen, und es müsste sichergestellt werden, dass es ein vernünftiges Nutzen-Risiko-Verhältnis gibt. Gegenwärtig ist das in keinem Szenario der Fall.

Weitere deutsche Meinungen – wie immer sehr gut vom DLF recherchiert – von Mario Brandenburg, René Röspel, Kirsten Kappert-Gonther und Reinhard Merkel. Fundamentale Einwände? Na sicher – stehen auf www.amnesty.de/alle-30-artikel-der-allgemeinen-erklaerung-der-menschenrechte  Artikel 5, 12, 16…

Sonntag 27.1.2019

Die Ethik Debatte in Wien mit seltsamen Argumenten

Zum einen gebe es eine Kontroverse darüber, was passiert ist: „Die Möglichkeit, die Faktizität zu beweisen, wird zum Teil der Ethikauseinandersetzung.“ So zweifelten nach Hes Schritt an die Öffentlichkeit sofort namhafte Wissenschaftler am Erfolg seiner Behandlung.

Nicht die Möglichkeit, sondern die Faktizität selbst, stand  am Anfang in Frage. Das würde ich aber nicht als Teil der Ethikauseinandersetzung sehen, denn wenn es sich herausgestellt hätte, dass He Jiankui nur geblufft hätte, dann hätte es keine Ethikdebatte gegeben, sondern allenfalls eine Diskussion wegen Wissenschaftsbetrugs.

Zum anderen, so Prainsack, werde die öffentliche Aufmerksamkeit zunehmend zu einem Einflussfaktor: „Man kann sich gegen solche Geschichten wie jene der Crispr-Babys nicht mehr wehren. Und es bleibt nur wenig Platz und Zeit für Fragen, die vielleicht sehr, sehr große Auswirkungen auf das Leben von Menschen haben.“

Auch das kann ich nicht nachvollziehen. Deskriptive Ethik beschreibt die innerhalb einer Gesellschaft gelebten Werte, wobei die Aufmerksamkeit nicht Einflussfaktor, sondern Gradmesser für die Normverletzungen innerhalb der Gesellschaft ist.

Darüber hinaus führte Prainsack, auch Mitglied der Bioethikkommission beim Bundeskanzleramt und der European Group on Ethics in Science and New Technologies, den sogenannten Ethikimperialismus ins Treffen: „Woher kommen denn die Normen, die He Jiankui gebrochen hat? Sie kommen allesamt aus Nordamerika und Europa.“

Auch das ist wenig  überzeugend. He Jiankui hat Werte und Normen des Taoismus, Konfuzianismus und Buddhismus verletzt, dazu chinesische Gesetzesvorschriften gebrochen. Schenken wir uns hier den Rest des Artikels.

Dienstag, 29.1.2019

Natürlich haben viel mehr über die Versuche von He Bescheid gewusst, als sie bisher zugegeben haben.  Der Nobelpreisträger Craig Mello wusste also schon im April 2018 (!) aus einer  “Success!” Email Bescheid, so AP gestern. Bisher wussten wir nur von der Email an Doudna mit “Babies Born” (“Thanksgiving” ist am vierten Donnerstag im November, also am 22.11.18). Die Videos kamen am 25.11.18, das Geburtsdatum war wohl aber am Tag des Registereintrages am 6.11.18. Damit errechnet sich ein Zeugungstermin am 12.2.2018. Rechnen wir 2 Wochen für das sicher Anspringen des ß-HCG im Urin und einer Email an Mello Anfang April, dann war die Schwangerschaft ca 3 Wochen verkürzt).

Mello declined requests for an interview. In statements provided through his university, Mello said he had no idea He was “personally interested” in human gene editing or had the means to pull it off, and that their discussions were “hypothetical and broad.” Mello repeated his disapproval of He’s project and said he resigned from Direct Genomics’ scientific advisory board because he felt that a company led by He could no longer be effective.

Es gibt ein PDF der Email, also nur 12 Tage für ß-HCGß-HCG, also müssen wir nochmal neu rechnen. Das Datum der Nachrichtist nicht perfekt anonymisiert – einstellig im April, ein Montag oder Freitag, bleiben nur 2., 6., 9. April minus 12 Tage.

Donnerstag, 31.1.2019

Nach einer Recherche von Bettina Markmeyer / epd gab es in Deutschland im letzten Jahr weniger als 350 PID Anträge.
Michael Deem gerät immer mehr unter Druck

Most notably, STAT has learned that Rice biophysicist Michael Deem was named as the senior author on a paper about the work that was submitted to Nature in late November… “As a prominent scientist from an elite university in the U.S., Deem’s presence is likely to have a significant role in persuading potential candidates to jump on board,” said Jia Ping, a human rights lawyer who is founder and chief executive officer of the Beijing-based nongovernmental organization Health Governance Initiative. They would not have known that neither Deem nor He had any experience conducting clinical trials.

Und jetzt kommt noch ein weiteres Puzzlestück – die Zeitschriften, die das Manuskript zum Review hatten.

One paper — submitted to Nature along with the CRISPR-babies paper in late November — modified the CCR5 gene, which encodes a protein that helps HIV enter and infect cells, the same gene He claimed he had altered in the twins to protect them against infection with the AIDS-causing virus. The other paper, which reported on the editing of the PCSK9 gene that encodes a protein that helps regulate the level of cholesterol in the bloodstream, was submitted to Science Translational Medicine. Both were rejected.

Die NYT mit einem seltsamen Titel “Should Scientists Toy With the Secret to Life?” aber ganz gutem Text.

virtually unaddressed in the many CRISPR discussions and reports and white papers so far, is what specific scientific tests must be done to determine whether edits made in a human embryo are “safe.”

Sicherheit ist natürlich eine fundamentale Frage, Braun/Schickl/Dabrock S.8 zum Trotz.

George Church soll gesagt haben

Harvard University scientist George Church, …, said it might not be the last time a lone wolf acts. “We either allow or outlaw,” he said. “If the latter, then we may drive it underground — just as it is moving from hypothetical speculation to rigorous testing.”

“normative Kraft des Faktischen” finde ich genauso wenig überzeugend wie “schiefe Ebene” Argumente.

Nina Fram zeigt dass die bisherige ethische Argumentation von Eigeninteresse getrieben war, bei He sowieso, aber auch bei der Biotech Community. Oder in anderen Worten, man darf es Forschern nicht überlassen, ihre eigenen Regeln aufzustellen. 

But when leading voices such as NIH Director Francis Collins assert that He’s work “represents a deeply disturbing willingness by Dr. He and his team to flout international ethical norms,” what are they actually expressing concern about? Who determines what are the ethics of altering human life? We believe that the alarm being sounded by the scientific community isn’t really about ethics. It’s about protecting a particular form of scientific self-governance, which the “ethics” discourse supports. What are currently treated as matters of research ethics are in fact political and social questions of fundamental human importance. Key decisions about when and how it will be appropriate to make inheritable changes to human beings currently lie in the hands of scientists. Although ethics are repeatedly invoked, the most prominent condemnations of He’s actions don’t actually address whether it’s ethical to tinker with human life through gene editing. A largely ignored part of the story are the five “draft ethical principles” of He’s lab at the Southern University of Science and Technology of China.

Gleich ob man ihr damit folgen mag oder nicht: Es ist der wichtigste Diskussionsbeitrag bisher in diesem Jahr.

Samstag, 2.2.2019

Irgendwie finden sich nun immer mehr chinesische Arbeiten, die menschliche Embryos genverändert haben, allerdings ohne Implantation: HBB und G6PD sowie ein CCR5 Paper. Aber auch in den USA geht die Forschung unverändert weiter.

Dieter Egli, a developmental biologist at Columbia University, says he is conducting his experiments “for research purposes.” He wants to determine whether CRISPR can safely repair mutations in human embryos to prevent genetic diseases from being passed down for generations. So far, Egli has stopped any modified embryos from developing beyond one day so he can study them.

Und völlig abgedreht “The DIY designer baby project funded with Bitcoin

For a few years now, Bishop, a 29-year-old programmer and Bitcoin investor, has been leaving a trail of comments about human “enhancement” on the web. He’s a transhumanist, which means he thinks humans can be improved in profound ways by technology. He’d long exhorted others to do something about the human condition.
Now, he had decided to do it himself.
According to the e-mail, sent in May, Bishop and his partner in the enterprise, Max Berry, a former biotech company lab scientist, were “starting a company focused on the production of designer babies and human germline genetic engineering.” He noted that “lab work has started” and “we have an initial parent-couple customer.”

Nun ja, um Intelligenz zu beeinflussen, müsste man 1016 Gene editieren. Aber dass das übernächste Genbaby aus der Biohacker Szene kommt, ist nicht ganz von der Hand zu weisen – wenn man weiss was in der Hunde und Pferde Szene schon alles üblich ist. Ich glaube ich muss nun mal auch “transgenic sperm” mit auf die Suchliste nehmen.

Sonntag, 3.2.2019

Der lesenswerte Einwurf eines Nicht-Ethikers

I would not get cosmetic surgery, but I would not ban it – and will try not to think ill of those who choose it.
So, how should we assess the ethics of new biomedical procedures when we know that society’s views may change? More specifically, what should we think of He Jiankui’s experiment with human babies?
First, look to see whether the procedure in question violates, at least fairly clearly, some rule in your ethical or moral code. If so, your choice may not be difficult. But if the procedure is unmentioned in your moral code, probably because it was inconceivable to the code’s creators, examine the consequences of the act.

Dienstag 5.2.2019

Es sieht so aus, als hätte der Vortrag in Hongkong die meisten Zuhörer bisher bei einer wissenschaftlichen Präsentation gehabt (die Mondlandung hatte 500 Millionen, die Beerdigung von Lady Di 2.5 Milliarden).

During the international summit in Hong Kong in November where He was called to explain himself, Bishop was one of more than 1 million people watching online, part of perhaps the largest audience ever for a scientific address.

Meinen Vortrag werde ich demnächst in München nochmal wiederholen. Interessant auch die ARRIGE Empfehlungen die ich bisher nicht kannte.

In March 2018, approximately 160 participants from 35 countries gathered in Paris to launch the ARRIGE (Association for Responsible Research and Innovation in Genome Editing) Initiative.

He Jiankui hat es sogar zweimal in die Neujahrsrede des Präsidenten der DFG Peter Strohschneider geschafft – einmal als “zunehmende Enthemmung” und einmal als “Ethosdumping”

Dies – so will ich in Parenthese hinzusetzen – ist ja das Menetekel der gentechnologisch mani- pulierten chinesischen Zwillinge: eine verantwortungsvergessene, global entgrenzte Forschungs- konkurrenz, in der gewinnt, wer am rücksichtslosesten Ethosdumping betreibt. Und das droht übrigens nicht allein auf internationaler, sondern auch schon auf europäischer und nationaler Ebene: Auch innerhalb der Mitgliedstaaten der Europäischen Union gibt es ja etwa im Bereich der Embryonenforschung ein klares Gefälle forschungsethischer Rahmensetzungen.

Dazu auch noch den Nachtrag “Wir nennen es unverantwortlich” in der FAZ 3.12.2019.

Mittwoch, 6.2.2019

Es gibt einen neuen Thread zur Ethik.
Antonio führt das inoffizielle Embryo Register wie den Medaillenspiegel bei Olympia.

 

Donnerstag, 7.2.2018

Einige neue Aspekte bei NPR , leider ist der FT Artikel über Xi Ping hinter einem Paywall

Yet from a legal perspective, it will be difficult for Chinese authorities to punish him, according to Lu, who is an expert on the country’s few laws applicable to He’s research.
“I hope this case will push the government to introduce more laws,” Lu says. “We’re developing so many new technologies — cellular immunology, artificial intelligence — without proper regulatory supervision; experimenting with them will become very dangerous.”
Following the controversy around He, Chinese President Xi Jinping called for new regulations on gene editing.

And there’s another cultural aspect of China that scientist Cheng says plays a big part in He’s work: the role of gender.
Cheng says He’s decision to justify his experiment this way was exploitative of troublesome aspects of gender imbalance in Chinese culture. “He Jiankui exploited the shame of the father, the desire of fatherhood, the societal expectation of how men are expected to carry on the family life,” says Cheng. “And that was used as a way to recruit volunteers and subjects for his experiment.”

Das letztere glaube ich nun weniger: He war wohl  überhaupt froh, einige “viable” Embryos zu haben, wobei das Geschlecht eher egal war.

Freitag, 8.2.2019

Etwas zynisch – Lovell-Badge freut sich über die gute PR (weiter siehe unten). In Stanford freut man sich eher weniger, wenn man nun eine Kommission am Hals hat, welche die eigene Beteiligung an dem Skandal untersucht. 

Offficials at Stanford University have opened an investigation into what several high-profile faculty members knew about a Chinese effort to create gene-edited babies led by a onetime researcher at the California school, He Jiankui.

Es wird nicht viel passieren, Stanford wird sich nicht selbst beschädigen wollen. Aber die Chinesen könnte den Amerikanern die Schuld zuschieben versuchen, das ist nicht von der Hand zu weisen.

University-led investigations are typically private, toothless affairs with few consequences for important faculty, especially those who pull in millions in grants. The question of research involving human subjects is a critical one, however, in part because serious violations can endanger a university’s federal research grants…

To some, the focus on foreigners suggests that China might try to spread the blame for the incident away from He and China’s weak oversight system. Chinese investigators could eventually disclose details about the involvement of US scientists, perhaps showing it was more extensive than currently understood.

Another view, also expressed by several scientists, is that He is unfairly being isolated and demonized while in fact a number of US scientists advised him or provided encouragement for his undertaking. These people worry He could be severely punished in China’s swift and opaque judicial system. If so, they say, his confidants now have a duty to speak up and disclose their role, despite risks to their own careers.

Es dämmert den Amerikanern mittlerweile auch, dass mit dem 1000 Talente Programm viel “intellectual property” abgeflossen ist, so STAT

NIH asks inspector general to investigate 12 allegations of foreign influence in U.S. research

oder noch massiver

NIH report scrutinizes role of China in theft of U.S. scientific research

Montag, 11.2.2019

Heute präsentiert das  Gabrieli-Gymnasium Eichstätt zusammen mit der KU Eichstätt ein Film zu dem Thema.

Ausserdem: Lovell-Badge mit einem Plädoyer für “genome editing“. Letztendlich haben alle JK gepusht auch wenn L-B versucht, sich hier aus der Affäre zu ziehen.

Although we were aware that he had not published in this area, he had clearly been doing relevant research and we thought it might be useful for him to attend the summit where the science, safety, ethics and regulatory issues surrounding genome editing would be discussed. We sent him an invitation and he responded almost immediately to say that he would be very happy to present.

AP hat offensichtlich die Videos produziert (Werbespruch “where the story begins”) aber dann den Scoop verloren.

It also turned out that JK had been using the services of a PR advisor who suggested that JK should have a journalist from Associated Press (AP) document his work and make videos to explain his research, so that he could make a big splash when the story was eventually released.

Die Argumentation wird in Folge aber recht einseitig, weil der Benefit allein das ja nicht entscheidet.

But are there instances in which genome-editing human embryos might be beneficial? In my opinion, there are.

Was dann folgt,  ist  mehr britischer Humor: Alle sind schliesslich  verantwortungsvoll, sonst würde es bereits viel mehr CRISPR Babies geben.

Donnerstag, 14.2.2019

Quelle:

Der Rumänische Minister George Ciamba hat im Namen des Rates der Europäischen Union (EU) klargestellt, dass Eingriffe in die menschliche Keimbahn ein Verstoß gegen die Grundrechtscharta der Europäischen Union sind. Das sagte er diese Woche in einer Plenardebatte in Straßburg… Aufgrund dieses Vorfalls hatten der Europaabgeordnete Peter Liese (CDU) und Miroslav Mikolášik eine Debatte beantragt. Peter Liese, gesundheitspolitischer Sprecher der größten Fraktion im Europäischen Parlament (EVP – Christdemokraten), sagte in der Debatte: „Gentechnik bietet große Chancen, die wir nutzen müssen, aber es muss ethisch motivierte Grenzen geben. Nicht alles, was technisch möglich ist, darf auch erlaubt sein. Eingriffe in die menschliche Keimbahn sind generell unverantwortlich.”

Das New England geht genau in die entgegengesetzte Richtung und sucht nun den “Weg nach dem Sturm”

The prospect of genome editing to prevent genetic disease, if determined to be safe, enjoys widespread public support, as shown by published opinion polls and engagement activities.

Trump hat wohl doch einen tiefen Einfluss auf die Wissenschaft “fake it ’til you make it”. Zum Glück wird Daley und Lovell-Badge umgehend widersprochen.

Donnerstag, 21.2.2019

Ein Interview in der ZEIT mit Armin Grunwald

Bei dem Skandal geht es um die Frage: Inwieweit darf ein Mensch andere Menschen kontrollieren? Wenn man Gene beliebig ausschalten kann, kann man Menschen designen. Das bedeutet eine fundamentale Fremdbestimmung. Die Babys konnten ja nicht zustimmen, was vor der Geburt mit ihnen gemacht wurde. Zu einem gewissen Grad ist jeder Mensch fremdbestimmt, etwa durch die Erziehung. Aber daran lässt sich nachträglich etwas verändern, zur Not mit einer Therapie. Wenn ein Designer das Genom umprogrammiert, kommt man da nicht raus.

Das Ethik Papier von He Jiankui wurde heute zurückgezogen

However, it has since been widely reported that Dr. He conducted clinical studies involving germline editing of human embryos, resulting in several pregnancies and two alleged live births. This was most likely in violation of accepted bioethical international norms and local regulations. This work was directly relevant to the opinions laid out in the Perspective; the authors’ failure to disclose this clinical work manifestly impacted editorial consideration of the manuscript.

Ausserdem veröffentlichte Cell einen Artikel über bislang unbekannte CCR5 Funktionen im Gehirn.

Mittwoch, 27.2.2019

STAT vermutet doch chinesische Förderung ohne allerdings viel Neues auf den Tisch zu bringen

When asked about the funding sources last November, after talking about his clinical trial at the Second International Summit on Human Genome Editing in Hong Kong, He said the work was paid for in part by his own savings and in part by a generous startup fund provided by the university when he was first recruited. Indeed, the university is listed as the funding source on two Chinese-language informed-consent forms provided to STAT, which He used to recruit male and female volunteers, respectively. He may also have been seeking support from another government entity. A source close to the Chinese health ministry told STAT that He’s team had been lobbying the government of the southern province of Hainan to set up IVF clinics specialized in germline editing — changing the DNA of embryos, eggs, or sperm.

Nature mit einem Essay wie es wohl weiter geht und einer Timeline

Donnerstag, 28.2.2019

mit relativ viel neuen Nachrichten. China kündigt harte Strafen für Änderungen am Erbgut von Babys an, wobei Berufsverbot und empfindliche Geldstrafen abschrecken sollen. Der österreichische Standard

Ein neues Regelwerk stuft Genmanipulationen bei Menschen als “hohes Risiko” ein und sieht Geldstrafen von umgerechnet bis zu 13.000 Euro vor. Forscher, die “illegale Einkommen” für ihre Studien erhalten, werden zudem mit Strafen vom bis zu Zwanzigfachen der Höhe ihrer Bezüge rechnen müssen. Last but not least droht ein lebenslanges Berufsverbot.

Ähnlich auch die Deutsche Welle (Original wohl Wall Street Journal). Die CRISPR Aktien steigen, sagt boerse.ard

Ob der Eingriff in das menschliche Erbgut nun Fluch oder Segen ist? Darauf antwortet das Schauspiel Hannover. Aber auch die Konrad-Adenauer-Stiftung mit der Forderung nach einem Forschungsmoratorium. Und auf achgut.com Johannes Eisleben.

Donnerstag, 14.3.2019

Die Genetic Alliance, eine der grössten US Selbsthilfe Organisationen, fordert ein Moratorium mit einer klaren Begründung

Parents could be put under powerful peer and marketing pressure to enhance their children.
Children with edited DNA could be affected psychologically in detrimental ways.
Many religious groups and others are likely to find the idea of redesigning the fundamental biology of humans morally troubling.
Unequal access to the technology could increase inequality.
Genetic enhancement could even divide humans into subspecies.
Moreover, the introduction of genetic modifications into future generations could have permanent and possibly harmful effects on the species.

Eric S. Lander, Françoise Baylis, Feng Zhang, Emmanuelle Charpentier, Paul Berg, Catherine Bourgain, Bärbel Friedrich, J. Keith Joung, Jinsong Li, David Liu, Luigi Naldini, Jing-Bao Nie, Renzong Qiu, Bettina Schoene-Seifert, Feng Shao, Sharon Terry, Wensheng Wei und Ernst-Ludwig Winnacker haben nun nach 6 Monate den Kompromissvorschlag eines Moratoriums auf den Weg gebracht (Nature gestern)

By ‘global moratorium’, we do not mean a permanent ban. Rather, we call for the establishment of an international framework in which nations, while retaining the right to make their own decisions, voluntarily commit to not approve any use of clinical germline editing unless certain conditions are met.

Und noch mal Bettina Schöne-Seifert (Ethik in der Medizin

Im Folgenden möchte auch ich eindringlich davor warnen, Dr. He als Totengräber der GLGE- oder gar der gesamten humanen Gentechnik-Forschung zu verstehen, wie es in Deutschland nicht wenige Meinungsführer zu tun geneigt scheinen … Zu dieser fundamental-ablehnenden Haltung, deren Ausmaß sich derzeit nur erahnen lässt, trägt offenbar auch ein gerütteltes Maß an genetischer Unbildung bei.

Eine gewagte Zuschreibung, die auf Mutmassungen beruht und trotzdem nicht vor Verunglimpfungen halt macht? Und das von jemand, der nie auf dem Gebiet geforscht hat? Als Meinungsführer muss man sich normalerweise inhaltlich qualifizieren (oder wählen lassen)

Wo vergleichende Genomstudien (GWAS) von riesigem Umfang zunehmend zeigen, welche Genveränderungen erst im multifaktoriellen Zusammenspiel krankmachen, steigen die Hoffnungen, eines Tages auch schwerste Beeinträchtigungen auf polygener Ebene erfolgreich zu behandeln.

Ich würde sagen, damit sinkt die Hoffnung auf Null, ganz abgesehen davon, dass SNP basierte Interaktionen bisher weitgehend unbekannt sind. Wären also 0 Punkte in einer Bio-Klausur. Und der menschliche Genpool ist nicht durch einen nobilitierenden Mechanismus entstanden? Ist weder die Schöpfung noch das Überleben unzähliger Menschen eine nobilitierende Eigenschaft? Lustig jedenfalls wie sich eine säkulare Ethikerin mit “gerüttelt Mass” bei einem Ausdruck aus der Bergpredigt bedient (Lk 6,38). 

Die Stimmung bleibt gemischt in Deutschland.

Freitag 15.3.2019

Viele Zeitschriften haben die Forderung nach einem Moratorium nachgedruckt, in Österreich, der Schweiz, und Deutschland.  So das Domradio

Deutsche Wissenschaftler begrüßten den Vorstoß für ein Moratorium, sehen aber Probleme bei der Umsetzung. Der Mannheimer Medizinrechtler Jochen Taupitz erklärte, die Wissenschaft sei weitgehend einig, dass Keimbahninterventionen zunächst nicht vertretbar seien. Schließlich war schon beim ersten internationalen Gipfeltreffen zum “Human Gene Editing” 2015 in Washington ein Moratorium vorgeschlagen worden. Nach Einschätzung von Taupitz wird eine Umsetzung angesichts weltweit unterschiedlicher Rechtssysteme und ethischer Vorstellungen schwierig. … Die Vorsitzende des Europäischen Ethikrates (EGE), Christiane Woopen, kritisierte, ein Moratorium müsste auch Sanktionen vorsehen. Und die Wiener Politikwissenschaftlerin Barbara Prainsack bemängelte Unschärfen. So sei nicht klar, ob Staaten oder Forschungseinrichtungen das Moratorium in Kraft setzen oder beenden sollten. Ein Konsens wird auch angesichts der zu erwartenden neuen Erkenntnisse nur sehr schwer zu erzielen sein.

Der Standard

Der Text ist ein wichtiges Statement. Ein Denkanstoß, der aber argumentative Lücken aufweist: Die Autoren und Autorinnen gehen weder auf die Form der Freiwilligkeit, die ihnen vorschwebt, ein, noch sagen sie, was bei Nichteinhaltung passieren soll. Auch wird aus dem Text nicht klar, wann eine Korrektur medizinisch vertretbar erscheint. Die Tatsache, dass Krankheiten subjektiv als mehr oder weniger schwerwiegend empfunden werden könnten, verlangt hier doch noch Nachbesserungen.

Das wichtigste haben aber alle deutsche Journalisten übersehen, nämlich wer nicht unterschrieben hat. STATnews

An equally stellar list of scientists are conspicuous by their absence. One, biochemist Jennifer Doudna of the University of California, Berkeley, supports “strict regulation that precludes use” of germline editing until scientific, ethical, and societal issues are resolved, she said in an interview. “I prefer this to a ‘moratorium’ which, to me, is of indefinite length and provides no pathway toward possible responsible use.”

Das Feld bewegt sich langsam auseinander, die Summits 2015 und 2018 waren wohl nur Akzeptanzbeschaffungsmassnahmen. Science dazu heute

Their call, which is endorsed in the same issue of Nature by Francis Collins, director of the U.S. National Institutes of Health, is a departure from statements or reports issued earlier by two global summits on genome editing, the U.S. National Academies of Sciences, Engineering, and Medicine, and the United Kingdom’s Nuffield Council on Bioethics. Those stress the promise of germline editing to help correct some heritable diseases but warn against using it for cognitive or physical “enhancement” of humans. Scientists including Nobel laureate David Baltimore of the California Institute of Technology in Pasadena remain opposed to a moratorium. Baltimore, who helped organize the summits, has previously denounced such a ban as “draconian” and “antithetical to the goals of science.”

Donnerstag 21.3.2019

Die WHO ist auch gegen einen Bann, ein Register soll es richten.

“The committee agrees it is irresponsible at this time for anyone to proceed with clinical applications of human germline genome editing,” said Margaret Hamburg, the panel’s co-chair and foreign secretary of the US National Academy of Medicine. But she emphasized that the WHO panel is not calling for a permanent moratorium on such research. “We are trying to look at the broader picture and a framework for responsible stewardship,” said Hamburg, a former commissioner of the US Food and Drug Administration. “I don’t think a vague moratorium is the answer for what needs to be done.”

Freitag, 22.3.2019

Endlich mal wieder ein längerer und dazu gut geschriebener Beitrag in der FAZ von Joachim Müller-Jung “Dieser Embryo gehört nicht zu uns”

Es schwingt in solchen Sätzen auch die Sorge ums große Ganze mit: Hilfe, wir dürfen die Kontrolle über unser Selbst nicht verlieren. Denn eines ist klar: Gen-Editierer, Klonforscher und Stammzelldesigner haben in den vergangenen Jahren eine neue ingenieurwissenschaftliche Disziplin hervorgebracht, die noch nirgends gelehrt wird und doch schon Realitäten verändert: „Human-Engineering“ definiert das Menschsein neu. […] „Es gibt in der Philosophie der Biologie die eindeutige Tendenz, den Speziesbegriff fallenzulassen“, stellte etwa Markus Rothhaar aus Eichstätt fest. Äußere Merkmale, morphologische Eigenheiten und Abstammungsgründe eigneten sich nicht mehr zur Abgrenzung. „Lange hat gegolten: Mensch ist, wer von einer Frau geboren wird. Das ist nicht mehr so klar“, so Rothhaar. Tatsächlich entstehen in den Laboren inzwischen durch Transfer von menschlichem und tierischem Gen- und Zellmaterial, durch Reprogrammierung und durch die Verschmelzung von Zellen unterschiedlicher Herkunft biologische Substrate […] Allzu viel Vertrauen in die aktuelle Biopolitik hat man in der Philosophie allerdings nicht, wie der Hagener Philosoph Thomas Sören Hoffmann deutlich machte: „Neuzeitliche Biopolitik kennt im Prinzip keine Vorbehalte gegen den Ausgriff auf das biologische Substrat mehr – sie verwaltet es, so wie sie zunehmend auch den Eintritt in die und das Ausscheiden aus der menschlichen Gesellschaft verwaltet.“

Dienstag, 26.3.2019

Dabrock kritisiert in der FR mit wenig inhaltlichen Argumenten den Moratoriumsvorschlag

„Es fehlt eine ausführliche Betrachtung und Reflexion der ethischen Kriterien in ihrer unterschiedlichen Deutung, Gewichtung und Mischung.“ Die Zivilgesellschaft weltweit müsse für das Thema sensibilisiert werden, schließlich gehe es um Menschheitsfragen. „Die eigentliche Arbeit ist noch zu tun.“ Dabrock nennt die internationalen Klimakonferenzen als mögliches Vorbild für eine ernsthafte Auseinandersetzung mit komplexen Sachfragen, weil sie „das Thema ins globale öffentliche Interesse heben“. Auf nationale Lösungen zu setzen sei zu schwach. Der Ethikrat hatte bereits 2017 gefordert, verbindliche internationale Standards für Keimbahneingriffe zu erstellen. Auf Bitten des Bundesgesundheitsministeriums erarbeitet das Gremium derzeit eine Stellungnahme, die die ethischen Argumente bündelt und bewertet. Sie soll im Mai dieses Jahres vorgestellt werden. Problematisch findet Dabrock auch die von den Moratoriums-Initiatoren vorgenommene Unterscheidung zwischen „genetischer Korrektur“ und „genetischer Verbesserung“ in der Debatte um die klinische Anwendung. Bei einer Korrektur geht es den Autoren zufolge darum, genetische Bausteine zu verändern, die mit hoher Wahrscheinlichkeit eine schwere Erkrankung hervorrufen. Bei der genetischen Verbesserung hingegen könne etwa ein Krankheitsrisiko modifiziert werden. Oder ein Mensch mit neuen genetische Informationen ausgestattet werden, die etwa die Gedächtnisleistung verbessern oder gänzlich neue Eigenschaften hervorbringen – zum Beispiel, im Infrarotbereich sehen zu können. „An dieser so völlig unüblichen Unterscheidung wird sich die wissenschaftliche Entwicklung nicht orientieren. Sie ist eine erkennbare Quelle für spätere Missverständnisse und Enttäuschungen in der Öffentlichkeit von der Wissenschaft“, so Dabrock.

Mutig, dem Nestor der deutschen Genetik Prof. Winnacker, vorzuwerfen.

Donnerstag, 28.3.2019

Auf feinschwarz.net philosophische und theologische Perspektiven von Nikolaus Knoepffler (Angewandte Ethik, Jena) zu posthumanen Wesen, die auf uns herabschauen könnten

In der philosophischen Diskussion wird das Enhancement sehr unterschiedlich bewertet. Der wesentliche Grund hierfür besteht darin, dass hinter den jeweiligen Bewertungen sich gegenseitig ausschließende Menschenbilder und nicht mehr vereinbare Vorstellungen von gelingendem Leben liegen.

Freitag, 29.3.2018

Es gibt wenig Reaktion auf den Vorschlag eines Registers oder eines Moratoriums,

ein paar Vorträge über den “He JK”- Vorfall, mehr nicht.

aber einen nicht unwichtigen Leserbrief in nature biotechnology 

The Nuffield Council on Bioethics in the UK also issued a report in July 2018 “Nuffield Council on Bioethics. Genome editing and human reproduction”. Notably, it concludes that germline genome editing could be permissible under certain circumstances. More strongly, it moves beyond the merely permissible to the ethically obligatory, saying in its final section (paragraph 5.2) that “there are moral reasons to continue with the present lines of research and to secure the conditions under which heritable genome editing would be permissible.” Here, we review the Nuffield Council report and show how its shortcomings are part of an increasingly permissive climate among elite scientists that may well have emboldened He. Without a robust and meaningful airing of the perils of human germline modification, these views are likely to encourage additional, more mainstream moves in the same dangerous direction.

Nichts anderes habe ich mir schon 2017 gedacht bei dem Nuffield Vortrag in Trient. So auch Bioedge

The rending of garments by horrified scientists after Chinese researcher He Jiankui announced that he had altered the germline of two babies was heard around the world. But was the outrage sincere? An article in Nature Biotechnology by two prominent genetic engineering sceptics suggests that it was not. Donna Dickenson, of the University of London, and Marcy Darnovsky, of the Center for Genetics and Society, in Berkeley, California, point out that “the words and actions of key US and UK scientists” encouraged He to proceed. In particular, they point an incriminating finger at last year’s report on human germline editing from the Nuffield Council on Bioethics, in the UK.

Und ein neues Buch gibt es: Hardt, Annika. Technikfolgenabschätzung des CRISPR/Cas-Systems. Über die Anwendung in der menschlichen Keimbahn. de Gruyter, 2019.



Freitag, 12.4.2019

Der Nobelpreisträger David Baltimore spricht sich gegen ein Moratorium aus. Der Trend geht eindeutig zur “elastischen Ethik” so auch ein Science Kommentar.

It’s largely a semantic issue. Statements made after the first summit and the second summit have avoided using the term moratorium. Consciously. Because that word has been associated with very firm rules about what you can do and what you can’t do.
I fully agree — and the whole group of us involved in the summits agree — that we’re not ready to be doing germline modification of humans, if we ever are. You might say, “Well, that’s a moratorium,” and, in a sense, it is. I don’t have a big argument about that.
But the important point is to be flexible going forward. That’s what’s wrong with a moratorium. It’s that the idea gets fixed in people’s minds that we’re making firm statements about what we don’t want to do and for how long we don’t want to do it.

Gleichzeitig gibt es immer mehr Mensch/Tier Hybride.  Bereits am 27.3.19 erschien in der in Beijing erscheinenden “National Science Review” ein Artikel (Kommentar in der NZZ)

Forscher erzeugen dabei Tausende Tiere, denen sie verschiedene menschliche Gene einsetzen, um deren Rolle in der menschlichen Entwicklung oder bei der Entstehung von psychischen oder neurologischen Erkrankungen zu untersuchen. Nun haben Forscher das Gen MCPH1 ins Erbgut von elf Rhesusaffen eingesetzt.

Regalado beschreibt das Vorgehen ausführlicher in Technology Review, das nichts anderes ist als sinnlose Tierquälerei ist. Es geht also gerade so weiter wie im Januar 2019 mit dem BMAL1 Makaken (siehe Kommentar des SWR), die auch in dem berüchtigten “National Science Review” erschien

Bei den jetzt geborenen Makaken handelt es sich um “Knock-Out”-Affen. Ihnen wurde mit der Genschere Crispr/Cas ein Gen entfernt. Ohne dieses Gen “BMAL1” sind Affen besonders anfällig für eine Reihe von Krankheiten. Ihre innere Uhr funktioniert nicht mehr richtig, sie bekommen leichter Schlaf- und Hormonstörungen, Depressionen und sogar Schizophrenie.

Donnerstag, 18.4.2019

Stanford spricht sich von jeder Schuld frei “Stanford researchers were not participants … and … had no research, financial or organizational ties.  Stephen Quake in der NYT , genau,  der die berühmte Email geschrieben hat ““Wow, that’s quite an achievement! Hopefully she will carry to term…” Und keine Reaktion auf den Brief von Bao Xinhe, dem Präsident der USTC der geschrieben hatte.

Prof. Stephen Quake provided instructions to the preparation and implementation of the experiment, the publication of papers, the promotion and news release, and the strategies to react after the news release

Dabei sickert auch heraus, dass es den Zwillingen nicht so gut ging wie He es berichtet hat.

About a week later, Dr. Heʼs publicist, Ryan Ferrell, contacted Dr. Quake, worried that Dr. He presenting the project publicly so soon could cause “severe and permanent harms to his reputation and the field.” And, “the twins are still in the hospital, so no positive imagery.”

Wer ist nur dieser dubiose Ryan Ferrel, der schon auf dem Ethik Papier mit He Jiankui stand? Ein PR Experte mit null PR Kontakten?

Mittwoch, 24.4.2019

Direkt aus chinesischen Regierungskreisen kommt die Nachricht das China ein neues Gesetz erwägt

Der Entwurf des Zivilgesetzbuchs hat einen unabhängigen Abschnitt über Persönlichkeitsrechte hinzugefügt. Er wurde Chinas oberstem Gesetzgeber für eine zweite Prüfung am Samstag vorgelegt. Er legt fest, dass Personen, welche medizinische oder wissenschaftliche Forschungen durchführen, die im Zusammenhang mit menschlichen Genen oder Embryonen stehen, sich an die Gesetze, administrativen Regeln und relevanten Regulierungen halten müssten, wie die Nachrichtenagentur Xinhua berichtete. […] „Menschen können nicht auf Meerschweinchen reduziert werden“, sagte Meng Qiang, ein Rechtsprofessor am Beijinger Institut für Technologie. „Strenge Prozeduren und insbesondere die Erlaubnisse von den Ethik-Komitees sind sehr wichtig.“ Liu sagte, dass die Funktion und die rechtliche Verantwortung von Ethik-Komitees erstmals in einem Gesetzesentwurf klar definiert worden seien. Dies könnte dabei helfen, Missbräuche in der Praxis zu vermeiden.

Mittwoch, 1.5.2019

Nature hat einen Leserbrief zu dem Thema. Warum aber gerade diesen einen Letter und nicht einen der tausend sonstigen Kommentare? Übermässig überzeugend ist es jedenfalls nicht gegen ein Moratorium zu sein, weil es irgendwo unterlaufen werden könnte. Caplan in PLoS Biology

The issue now is not whether the work supporting the claims reported from China was done in an ethical manner. It was not. What is required to move for- ward is a justification for doing germline editing in humans. Many think there is none, and prohibitions abound.

ibd ein mehr technischer Kommentar aus Shanghai

His presentation revealed a troubling lack not only of basic medical ethics but also of the requisite understanding of genetics and gene editing.

Dienstag, 7.5.2019

Nature hat einen weiteren Artikel über Ethik in China.

Two weeks before the summit, He had attended China’s biannual bioethics conference in Shanghai — along with one of us (R.L.), who chaired a session on how to avoid the premature application of gene editing in clinical trials. That He said nothing about his research

und kritisiert dann eigentlich die gesamte aktuelle Forschung

Moreover, researchers who can declare that they are the first to discover something, both in Asia and in the world, are disproportionately rewarded when it comes to peer review, hiring decisions and funding … In our view, researchers in China are increasingly motivated by the promise of fame and fortune, rather than by a genuine desire for discovery, or a wish to help people and society.

Da die Untersuchungskommission keine medizinischen Daten der Zwillinge veröffentlicht hat, und die Familie “unter Überwachung” steht wie auch andere Dissidenten, ist nicht sicher, ob die Kinder noch am Leben sind.

Donnerstag, 9.5.2019

Der deutsche Ethikrat hat getagt: “Keimbahneingriffe sind derzeit zu risikoreich, aber ethisch nicht grundsätzlich auszuschließen

Zwar hält er die menschliche Keimbahn nicht für unantastbar. Gleichwohl beurteilt er Keimbahneingriffe derzeit wegen ihrer unabsehbaren Risiken für ethisch unverantwortlich. Deshalb fordert er ein Anwendungsmoratorium und empfiehlt Bundesregierung und Bundestag, sich für eine verbindliche internationale Vereinbarung dazu einzusetzen. Unstrittig ist im Deutschen Ethikrat zudem, dass jede angemessene Beurteilung von Keimbahneingriffen über eine reine Chancen-Risiken-Abwägung hinausgehen muss und nur unter Berücksichtigung von acht ethischen Orientierungsmaßstäben befriedigen kann: Menschenwürde, Lebens- und Integritätsschutz, Freiheit, Schädigungsvermeidung und Wohltätigkeit, Natürlichkeit, Gerechtigkeit, Solidarität und Verantwortung. In seiner Stellungnahme entfaltet der Ethikrat diese Orientierungsmaßstäbe und wendet sie exemplarisch auf den vor einer Anwendung von Keimbahninterventionen notwendigen weiteren Forschungsprozess sowie auf drei mögliche Einsatzgebiete an: die Vermeidung schwerer erblicher Erkrankungen, die durch die Veränderung eines einzelnen Gens verursacht werden, die Verringerung multifaktorieller Erkrankungsrisiken und die gezielte Verbesserung menschlicher Eigenschaften und Fähigkeiten (Enhancement). Dabei zeigt sich, dass es bei aller Einigkeit bezüglich des politischen Handlungsbedarfs zu vielen Fragen unterschiedliche Positionen gibt – auch im Deutschen Ethikrat. Beispielsweise halten nicht alle Mitglieder Keimbahneingriffe überhaupt für sinnvoll. Eine große Mehrheit bewertet die Weiterentwicklung und den Einsatz der Technologie mindestens zur Vermeidung oder Verringerung genetisch bedingter Krankheitsrisiken als ethisch legitimes Ziel. Für andere Mitglieder lassen Keimbahneingriffe keinen ausreichend hochrangigen Nutzen erkennen, der ihre potenziellen Nachteile rechtfertigen könnte.

wobei die Zusammenfassung in einem Satz oben offensichtlich nicht stimmt. Und was wohl der “pseduowissenschaftliche Plot” soll? Aber aus der Biobanken Geschichte wissen wir ja auch wie sehr der Ethikrat in seiner ersten Stellungnahme daneben lag.

Freitag, 10.5.2019

Deutsche Ärzteblatt mit Kritik

Die Stellungnahme des Deutschen Ethikrates zu Möglichkeiten, in das Genom menschlicher Embryonen oder in Keimzellen einzugreifen, ist auf ein geteiltes Echo gestoßen. Allgemeine Zustimmung fand die Forderung des Rates nach einem Mora­torium für die klinische Anwendung von Keimbahneingriffen. Vertreter der Union begrüßten die Stellungnahme als „guten Ausgangspunkt“. Deutlich kritisch äußerten sich hingegen SPD, FDP und die katholische Kirche zu Teilen des Papiers.

Dabrocks Selbstvermarktungs-Bauchladen mit Dumpingangeboten zu Psychiatriereform, Masernimpflicht, Digitalisierung und Crispr Babies. DLF“>DLF

Ein Eingriff in die menschliche Keimbahn ist uns derzeit absolut zu risikoreich, derzeit unverantwortlich, aber kein Mitglied des Deutschen Ethikrates hat gesagt, dass man sich das grundsätzlich überhaupt nicht vorstellen könnte. Also wir sagen nicht, es ist kategorisch verboten, in die menschliche Keimbahn einzugreifen, aber es müssen bestimmte Voraussetzungen, wenn überhaupt, erfüllt sein … Es muss natürlich so sein, dass es hinreichend sicher ist – uns ist beiden klar, dass das ein durchaus offener Begriff ist – und hinreichend wirksam sein. Dann kann man überhaupt nur darüber nachdenken, einen solchen Eingriff durchzuführen … Der Deutsche Ethikrat debattiert diese Fragestellung, aber auch unter der Maßgabe, dass es derzeit sehr unwahrscheinlich ist, dass so etwas – gerade wenn man so an Superman denkt – realisiert wird, aber wir debattieren es unter der Maßgabe, dass das sehr unwahrscheinlich ist, dennoch, weil uns ja doch die Entwicklung, die wissenschaftliche Entwicklung in diesem Gebiet in den letzten Jahren, wenn man ehrlich ist, doch zum Teil alle nicht nur überrascht hat, sondern überrollt hat.

Man könnte fast glauben mit dem Presse-Echo, dass der Ethikrat mehrere Dokumente veröffentlicht hat

Hajo Zenker kommentiert

So einleuchtend klingt, was das Gremium aufgeschrieben hat: Die Voraussetzung für solch einen geregelten Weg ist ein weltweites Moratorium. In Zeiten, wo multilaterale Verträge aus der Mode zu kommen, scheinen und immer mehr Staaten vor allem an den eigenen Vorteil denken, ist es aber alles andere als klar, dass es dazu kommt. Zudem: Für die Gen-Schere braucht man keine riesigen Labore. Es gibt genug ehrgeizige Wissenschaftler, die sich selbst bei Verkündung eines offiziellen Moratoriums von einem drohenden Publikationsverbot nicht schrecken lassen. Der chinesische Professor, der die beiden ersten „Designer-Babys“ zu verantworten hat, nutzte zur Unterrichtung der geschockten Weltöffentlichkeit ja auch Youtube. Ob die neue Menschheitsepoche Fluch oder Segen bedeutet, ist längst noch nicht ausgemacht.

Rene Röspel (SPD Bundestagsabgeordneter) hat einen sehr treffenden Kommentar auf seiner Webseite

Die Forderung des Deutschen Ethikrates nach einem internationalen Moratorium für die klinische Anwendung von Keimbahneingriffen an Menschen ist, auch vor dem Hintergrund der in China möglicherweise durchgeführten Experimente an mittlerweile geborenen Kindern, ausdrücklich zu begrüßen. Die SPD-Bundestagsfraktion wird diesen Vorschlag aufgreifen und prüfen, inwieweit er realisierbar ist. Erstaunlich ist, dass der DER Eingriffe in die menschliche Keimbahn unter bestimmten Bedingungen für zulässig hält und maßgeblich die technische Machbarkeit als zu erfüllende Voraussetzung sieht. Leider lässt der DER die zentralen Fragen – neben der selbstverständlichen Bedingung, dass ein solches Verfahren medizinisch sicher sein muss –, wer mit welchem Recht und nach welchen Maßstäben das Genom bzw. die Eigenschaften eines noch nicht geborenen Menschen verändern darf, im Wesentlichen unbeantwortet. Die große Mehrheit des Ethikrates hält Keimbahneingriffe zur Vermeidung monogen bedingter Erkrankungen für zulässig, ohne aber vorzuschlagen, wie dies eingegrenzt werden kann. Warum dann nicht auch sogenanntes Enhancement (sinnvoll erscheinende Verbesserungen) gemacht werden dürfte, wird ebenso offen gelassen. Damit weckt die Stellungnahme eher Hoffnungen, die nicht erfüllt werden können, als dass sie eine hilfreiche Grundlage für eine inhaltlich breite Debatte darstellt, wie sie der Bundestag und die Gesellschaft zu ethischen Fragen der Forschung bereits geführt haben. Die SPD-Bundestagsfraktion wird sich unter Einbeziehung dieser Stellungnahme weiterhin mit diesem Thema befassen.

Das Wall Street Journal (paywall) hat einen längeren Artikel der einige bisher nicht bekannte Details enthält

The twins had a secret almost no one at the hospital knew. One man who did know was there, waiting—a U.S.-educated researcher, Dr. He Jiankui, who had flown into town to see them. The twins were his creations, the world’s first known gene-edited human babies. He had worked toward this for two years, altering their genes as embryos to try making them resistant to their father’s HIV infection. Dr. He (pronounced “huh”) gave them pseudonyms, Lulu and Nana. “I’m 70% happy and 30% uncertainty,” he said in an English voice message to a colleague that night. A picture of just how far the scientist went to fulfill his dream emerges from a Wall Street Journal examination of his notes, emails, voice memos, clinical-trial documents and from interviews with people who knew him, some of whom were familiar with his trial, and the birth of the babies. His drive and interests were hardly secret: A small group of highly regarded Western peers watched from the sidelines, offering advice and urging caution… His team found 22 couples eager to conceive, some with fertility issues. The men were HIV-positive; the women weren’t. Visiting their homes, Dr. He’s team used PowerPoint slides to show how they would develop the couples’ embryos and edit genes to cause a mutation that research showed made it possible to resist HIV. The embryos would be implanted in the mothers. Some slides noted potential risks, such as unintended consequences. Others showed a woman saying: “I want a child.”

Montag, 20.5.2019

China macht einen Aufschlag, der einfach und klar verständlich ist: Prinzip Verantwortung (Hans Jonas) “die Vermeidung unabschätzbarer Risiken, um den Bestand der Menschheit als Ganzes nicht zu gefährden, sowie der Anerkennung der Eigenrechte der ganzen Natur, für die dem Menschen aufgrund seiner Handlungsmöglichkeiten die Verantwortung zukommt”

China is poised to introduce a new regulation on gene editing in humans. A draft of the country’s new civil code lists human genes and embryos in a section on personality rights to be protected. Experiments on genes in adults or embryos that endanger human health or violate ethical norms can accordingly be seen as a violation of a person’s fundamental rights. Lawyers say the regulation would mean that anyone who manipulates genes in humans is responsible for what happens to a person. “The law makes clear that those who do research with human genes and embryos cannot endanger human health or violate ethics,” says Zhang Peng, a criminal-law scholar at Beijing Wuzi University.

Montag, 27.5.2019

Die MPG veröffentlicht auch ein neues Positionspapier.

Eingriffe in die menschliche Keimbahn oder die Verwendung menschlicher Embryonen für die wissenschaftliche Forschung sind in Deutschland und 13 weiteren europäischen Ländern verboten. Anders als die Genom-Editierung von Körperzellen wirken sich Eingriffe ins Erbgut von Embryonen oder Keimzellen nicht nur auf einen einzelnen Menschen, sondern auf künftige Generationen aus. Die erbliche Genom-Editierung von Menschen würde unter anderem das Selbstbestimmungsrecht künftiger Generationen einschränken. In ihrem Positionspapier lehnt die Max-Planck-Gesellschaft Eingriffe in die menschliche Keimbahn zum derzeitigen Stand der Technik ab. Zentrale Sicherheitsbedenken und ethische Fragen sind noch ungelöst. Darüber hinaus gibt es bereits bedeutend sicherere Alternativen wie zum Beispiel die Präimplantationsdiagnostik. Damit die Keimbahn‐Editierung des Menschen eingesetzt werden kann, müssen erst die ethischen Konflikte gelöst und der mögliche Nutzen und Schaden durch unerwünschte Effekte in nachfolgenden Generationen abgewogen werden. Eine weitere Komplikation besteht darin, die Grenze zwischen der Heilung einer Krankheit und der Verbesserung kognitiver oder anderer Merkmale zu ziehen. Solange es keinen klaren Weg zur Lösung solcher ethischen Fragen gibt, empfiehlt die Max‐Planck‐Gesellschaft keinen Einsatz der Genom‐Editierung in der menschlichen Keimbahn.

Sonntag, 2.6.2019

STAT berichtete bereits letzte Woche über Trittbrettfahrer in Dubai ohne dass Details bekannt wären

A fertility clinic in Dubai emailed He Jiankui on December 5 — just a week after he announced the births — asking if he could teach its clinicians “CRISPR gene editing for Embryology Lab Application.”

Donnerstag, 6.6.2019

Es zeigt sich, dass CCR5-Δ32 Träger eine reduzierte Lebenserwartung haben

Wei and Nielsen in this issue of Nature Medicine set out to assess the effect of CCR5-Δ32. They took advantage of genotype and death register information in the UK Biobank12 for over 400,000 people between the ages of 41 and 76. By calculating the frequencies of CCR5 genotypes, they concluded that homozygosity for CCR5-Δ32 increased the rate of mortality in this age group by 20%.

Die Tagespost (katholische Wochenzeitung für Politik, Gesellschaft und Kultur) kommentiert mit “Der Hybris ein Ende

„Schreiben ist leicht. Man muss nur die falschen Worte weglassen“, witzelte einst Mark Twain. Wer wüsste besser als Journalisten, wie kompliziert dies sein kann? Unendlich kompliziert gestaltet sich das Schreiben jedoch für den, der die falschen Worte in einer Sprache wegzulassen sucht, die er nur in Ansätzen versteht und von deren Grammatik er allenfalls eine rudimentäre Kenntnis hat.

Allerdings (Stand 14.10.2019) wird die Studie wieder zurück gezogen.  Wissenschaft läuft offensichtlich hier mehr über Blogs als über Peer Review.

Dienstag, 11.6.2019

Der Tagesspiegel hat als erstes Nature gelesen, dann kommen auch andere wie der SPIEGEL.

Der russische Wissenschaftler Denis Rebrikov plant offenbar, mehreren Frauen noch in diesem Jahr Embryonen in die Gebärmutter einzusetzen, deren Erbgut er zuvor mit der Gen-Schere CRISPR/Cas9 (Crispr) verändern will. … Anders als der chinesische Kollege will Rebrikov nicht HIV-infizierten Vätern helfen, deren Risiko der Übertragung der Viren an die Nachkommen bei geeigneten Schutzmaßnahmen ohnehin gering ist, sondern HIV-infizierten Müttern. Seine Methode biete „größere Vorteile“, habe „weniger Risiken“ und sei „ethisch gerechtfertigter und akzeptabler für die Öffentlichkeit“, zitiert „Nature“ den Forscher, der an Russlands größter Befruchtungsklinik, dem Nationalen Medizinischen Forschungszentrum für Geburtshilfe und Gynäkologie „Kulakov“ in Moskau ein Labor für Genomeditierung leitet. … Darüberhinaus könne er mit einer „neuen“, allerdings noch nicht in Fachjournalen veröffentlichten Technik sicherstellen, dass die Gen-Schere Crispr das Zielgen CCR5 nur in der gewünschten Art und Weise verändere und keine versehentlichen Schnitte an anderer Stelle im Erbgut setzt, so genannte „Off-Target-Effekte“. Anders als He Jiankui in China, will der Russe allerdings die ausdrückliche Genehmigung der Experimente durch die zuständigen Behörden abwarten. … Rebrikov hofft, das russische Gesundheitsministerium werde die Regeln für einen klinischen Einsatz des Genome Editing „innerhalb der nächsten neun Monate“ klarstellen, schreibt „Nature. Allerdings „fühle“ der Forscher eine gewisse Dringlichkeit, HIV-infizierten Frauen zu helfen und sei „versucht“ mit den Experimenten fortzufahren, bevor Russland Regulierungen vornimmt.

Im Original: “I think I’m crazy enough to do it“.

Donnerstag, 4.7.2019

Der Titel hier ist ja eigentlich der “chinesische” Menschenversuch, aber nun versucht sich doch auch ein Russe mit allen PR Mittel am genetischen Transhumanismus. Er hat jetzt mal auch gerade die Strategie geändert laut New Scientist, interessant anderen beim Denken in Zeitlupe zuzuschauen.

Both would-be parents in each couple have a recessive form of deafness, meaning that all their children would normally inherit the same condition. While the vast majority of genetic diseases can be prevented by screening IVF embryos before implantation, with no need for gene- editing, this is not an option for these couples. … That is exactly why Rebrikov, at Russiaʼs largest fertility clinic, the Kulakov National Medical Research Center for Obstetrics, Gynecology and Perinatology in Moscow, has sought out these very unusual couples. “It is clear and understandable to ordinary people,” he says. “Each new baby for this pair would be deaf without gene mutation editing.” Now Rebrikov has told New Scientist that he also wants to prevent children inheriting a form of deafness caused by mutations in the GJB2 gene. In western Siberia, many people have a missing DNA letter in position 35 of the GJB2 gene. Having one copy has no effect, but those who inherit this mutation from both parents never develop the ability to hear.

Mittwoch,10.7.2019

Diese Woche müsste eigentlich das dritte Crispr Baby geboren werden. In der Tat, Antonio hat auch mitgezählt, nicht nur die Schwangerschaftswochen, sondern auch was sonst in der Zwischenzeit passiert ist. Ich meine allerdings mich zu erinnern, dass das dritte Kind nicht CCR5 modifiziert ist. Technology Review von gestern

Now the guessing game among CRISPR watchers is whether China’s government will ever acknowledge the third CRISPR baby. Rosario Isasi, a bioethicist at the University of Miami, says she has encouraged science leaders there to “make a statement and do damage control.” But the government may not want more attention, and experts in China are reluctant to discuss He’s experiment on social-media networks such as WeChat, which are monitored. “The government is extremely aware of any transgressions. They have the Tiananmen anniversary, they have the Hong Kong protests, and they have the CRISPR babies,” says Isasi.

Das stimmt natürlich… Diese Woche hat mir eine Kollegin auch einen interessanten Crispr Artikel geschickt, der schon am 5.3.19 erschienen ist: Unexpected genomic rearrangements at targeted loci associated with CRISPR/Cas9- mediated knock-in Damit sind erheblich mehr Schäden zu befürchten, die JK mit einfacher Brücken PCR / Illumina NGS nicht entdeckt hat.  Ich hoffe, mein Vorschlag kommt doch noch durch.

Freitag,26.7.2019

Lieder ist nichts über das Kind herauszubekommen, sieht alles nach einer gezielten Nachrichtensperre aus. Das Handelsblatt hat einen (konfusen) Artikel, wer an der Gentechnik verdient.

Quelle: https://www.handelsblatt.com/technik/medizin/der-perfekte-mensch-wie-moderne-gentechnik-die-medizin-revolutioniert-und-wer-daran-verdient/24687852-all.html

 

Dienstag,30.7.2019

Japan erlaubt erstmal weltweit Mensch-Tier Hybride.

Mittwoch,8.8.2019

Andere machen einfach mal, so das Ärzteblatt

La Jolla/Murcia – Forscher aus Spanien und China haben angeblich menschliche, induzierte pluripotente Stammzellen (iPS-Zellen) in Embryonen von nicht menschlichen Affen, wahrscheinlich Makaken, verpflanzt. Das berichtete El País vergangene Woche. Das Team um den spanischen Wissenschaftler Juan Carlos Izpisúa Belmonte habe zum ersten Mal in einem Labor in China ein Mensch-Affen-Hybrid geschaffen, bestätigte die Projektmitarbeiterin Estrella Núñez gegenüber der spanischen Tageszeitung.

doch Deutschlands Oberethiker wiegelt die Überschreitung der Artengrenze ab

Der Vorsitzende des Ethikrates sieht auch die Chancen der Forschung […] Die erste Empörung über die Versuche in Japan bezeichnete Dabrock als “Sturm im Wasserglas”. Er warnte davor, die Forschung an Mensch-Tier-Wesen vorschnell zu verurteilen. “Natürlich ist nachvollziehbar, dass man erst einmal Grusel empfindet”, sagte der Vorsitzend des Deutschen Ethikrats. […] Hinter dem Experiment stehe durchaus ein hohes und berechtigtes Ziel, betonte der Theologe. Er verwies auf einen großen Nutzen in der Organspende.

Montag,19.8.2019

Zwei Tagungsankündigungen, das Thema interessiert wohl nur noch Experten.

Keimbahneingriffe mit CRISPR/Cas. Zukunftsperspektive oder Irrweg? 12.-13.9.2019, Hannover.

(Re)Produktion und (Re)Kombination – Humane artifizielle Gameten und Genomeditierung in Ethik und Recht. 29.10.19, Berlin.

Dienstag,10.9.2019

Ein Nachtrag zum 1.8.: “The untold story of the ‘circle of trustʼ behind the worldʼs first gene-edited babies” Science Magazine, written by Jon Cohen“.

Because the Chinese government has revealed little and He is not talking, key questions about his actions are hard to answer. Many of his colleagues and confidants also ignored Science’s requests for interviews. But Ryan Ferrell, a public relations specialist He hired, has cataloged five dozen people who were not part of the study but knew or suspected what He was doing before it became public. Ferrell calls it He’s circle of trust.

Neu dabei vor allem die Rolle von Yu Jun (Beijing Institute of Genomics) und das Selfie mit Doudna

Ein Nachtrag zum 20.8.: Scientific America Blog ein Beitrag von Mildred Solomon: “It’s Not Just about Safety”.

[the] border between germ-line and somatic genome modification is blurring; the zeitgeist feels different. There is a growing sense of inevitability that we will eventually do human germ-line modification and that our only obligation is to wait until it is safe… But it will take sustained courage to address all of the implications of this technology. In a pluralistic society, it can be frightening to open the Pandoraʼs box of discussion about deeply held values. With so many different views that are seemingly impossible to reconcile, it will be easier to focus only on safety, which is the bare minimum that just about everyone can agree on.

Ein Nachtrag zum 23.8. An diesem Tag erschien auf german.china.org.cn die Ankündigung einer chinesischen Kommission.

„Es gibt seit langem Aufrufe, eine Ethikkommission auf höchster Ebene einzurichten, um eine einheitliche Überwachung der wissenschaftlichen Forschung zu ermöglichen”, sagte Zhai Xiaomei, stellvertretende Direktorin des Expertenausschusses für Medizinethik bei der Nationalen Gesundheitskommission. China hatte am 24. Juli die Einrichtung einer nationalen Ethikkommission für Wissenschaft und Technik angekündigt, Einzelheiten wurden jedoch noch nicht bekannt gegeben. Die Kommission soll eine wirksame Aufsicht und Regulierung des Sektors fördern, einschließlich der Rechtsvorschriften über die ethische Kontrolle… 

Und zuletzt am 2.9. von Stefan Rehder ein gelungener Artikel in der Tagespost zu den 60 Mitwissern.

Montag, 16.9.2019

Ein Bericht  der Tagung in Berlin.

„Es mehren sich international die Stellungnahmen von Fachverbänden, Wissenschaftsorganisationen und Ethikgremien, die über eine Lockerung des Verbotes der Keimbahntherapie diskutieren oder sie explizit fordern“, sagte Bijan Fateh-Moghadam aus Basel, Experte für Life-Science-Recht, dazu auf der Tagung. „Dass wir nicht am Status des Embryonenschutzgesetzes von 1990 festhalten sollten, ist unter Rechtswissenschaftlern weitestgehend Konsens.“Regine Kollek aus Hamburg, die sich mit Technikfolgenabschätzung beschäftigt, widersprach. „Eine PID und ein Verwerfen von Embryonen müsste auch hier gemacht werden.“ Sie erinnerte daran, dass die Genomeditierung gegenüber der PID nur in dem seltenen Fall vorteilhaft sei, wenn beide Eltern Träger der Genmutation seien und keine „normale“ Genkopie vererben könnten.

Mittwoch, 2.10.2019

Die US National Academy, die offensichtlich auch schon JK als Rechtfertigung gedient hat, kündigt in einem dubiosen Tweet ein noch dubioseres Youtube Video an Mischt Rußland jetzt ganz offiziell hirt mit? Bloomberg schreibt zu Future of Genetically Modified Babies May Lie in Putin’s Hands.

Six weeks after Nature’s call to action, some of Russia’s top geneticists convened a secret meeting with health officials at a facility in southern Moscow that included a special guest with unusual access to the Kremlin: Vladimir Putin’s eldest daughter, according to three people who were there. Figuring that in Russia only Putin can decide how to regulate an emerging technology capable of changing the code of every living cell, the geneticists wanted to present their conflicting opinions about Rebrikov’s intentions in front of Maria Vorontsova, an endocrinologist whose views on bioethics are becoming increasingly influential, the people said … Putin, 66, has made it increasingly clear in recent years that he expects genetic engineering’s eventual impact on society to be as great as or even greater than artificial intelligence—in ways both good and bad. In 2017, he predicted “people” would start editing pre-birth human DNA “very soon,” a development with possible military applications that he’s warned could be “more terrible than a nuclear bomb.” Last year, before He revealed his achievement, which was widely condemned, Putin allocated about $2 billion for genetic research and named Vorontsova to the 30-person panel overseeing the work. It’s an area of study that Putin has said will “determine the future of the whole world.”

Samstag, 5.10.2019

Trailer zu einer neue Netflix Serie

The documentary series UNNATURAL SELECTION explores new developments in the science of gene-editing that defy evolution and raise moral, social and environmental impact questions about where we, as a society, draw the line.